دانلود نقد و بررسی آثارپابلو پیكاسو در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود نقد و بررسی آثارپابلو پیكاسو در فایل ورد (word) دارای 92 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود نقد و بررسی آثارپابلو پیكاسو در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود نقد و بررسی آثارپابلو پیكاسو در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود نقد و بررسی آثارپابلو پیكاسو در فایل ورد (word) :

دانلود نقد و بررسی آثارپابلو پیكاسو در فایل ورد (word)

هنر این سخنگوی روح انسانی از بدو تولد انسان تا آخرین دم اسرار درونی و عواطف واحساسات ما را بیان می كند . بشر از همان ابتدای خلقت در پی آفرینش وخلق زیبائی بوده چرا كه خداوند در قرآن كریم می فرماید: « از روح خود در انسان دمیدیم » و این روح آفرینش وزیبا آفرینی خداوند است كه در ضمیر همه انسانها وجود داشته وانسان را از همان ابتدای كودكی به آفرینش زیبایی رهنمون می سازد از آنجا كه خداوند انسانها را از یك جنس ولی متفاوت از هم آفریده این حس زیبایی آفرینی در برخی بیشتر ودر برخی كمتر، و گاهی به صورت موسیقی و شعر وگاهی به صورت نقاشی وتصویر بروزمی كند .

نقاشی یكی از اولین هنرهایی بود كه انسان به آن گرایش پیدا كرد . آنچه عوام از نقاشی می دانیم كشیدن تصاویری است كه دید انسانی از مناظر دارد وهر چند این تصویر واقعی تر وبه اصل نزدیكتر باشد نقاش چیره دست تر و متبهر تر به نظر می رسد . سالها تفكر مردم از نقاشی چنین بود شاید هنوز هم بسیاری با این فكر زندگی می كنند اما در سال 1881 هنرمندی به دنیا آمد كه تمام بافته های ذهن انسانها ودنیای غرب را از نقاشی تغییر داد . او كه با نقاشی وهنر به دنیا آمد و پایه گذار بزرگترین انقلاب در عرصه هنر جهان شد كسی نبرد جز پابلو پیكاسو .

پیكاسو نمونه كامل وبارز یك انسان خلاق و نو آور بود . او شاید یكی از غیر منتظره ترین وغیر قابل پیش بینی ترین هنرمندان عرصه گیتی بود . او با عرضه كبویسم به دنیای نقاشی به حكومت سرد و طولانی رنسانس بر این هنر پایان داد . رنسانسی كه نقاش ، محكوم و مجبور به كشیدن توهمات دید انسانی می كرد و نقاش مانند دوربین عكاسی فقط به ثبت مناظر مانند آنچه می دید می كرد . اما پیكاسو با نو آوری خود این آزادی را به نقاشی داد تا مانند شاعر تر اوشات ذهن و روح خود را بر بوم طراحی كند واز آنچه خداوند در نها د او گذاشته واز عشقی كه در وجودش دارد با بیننده سخن بگوید این بهترین وعالیترین مرحله پیشرفت در نقاشی از ابتدای خلقت این هنر زیبا بود .

شاید هیچ هنرمندی به اندازه پیكاسو با این همه رسانه متنوع كار نكرده باشد از نقاشی رنگ روغن گرفته تا طراحی ، مجسمه سازی ، گرافیك ، سرامیك واز آنجا كار با ابزارهایی چون گرایش ، پاستل ، مداد رنگی و آفریدن لیتو گرافی‌ها ، چوبكاری ها ، پیكره هایی از كچ و چوب ، ساختواره هایی از آهن و مفتول ، چوب یا ورقه های فلزی ، عكسها و طرحهایی برای لباس و پرده های پیش صحنه و پس صحنه تاتر و باله وسرانجام شعرونمایش نامه نویسی .

هیچ هنرمندی با این همه سبك و شیوه گوناگون وگاه متضاد كا رنكرده است . از امپرسیونیسم مانه بزرگ تا اكسپرسیونیسم ون گوك ، از غرابت نمادین گوگن تا شاد گونگی امپرسیونیسی تولوز لوترك ، از منریسم الگور كوك وهنرمندان بادوك تا كلاسی سیم استادان قدیم ، از سورژنالیسم و كانتراكتیویسم وهنر سیاه واره تاكوبیسم كه خود بنیان گزارش بود .

به تحقیق درباره هیچ هنرمندی ، دست كم در زمان حیاتش به اندازه پابلو پیكاسو مقاله ، كتاب ، رساله ، تغییر نقد و یاد داشت نوشته نشده است . شمار كتابها و نوشتارهایی كه درباره پیكاسو انتشار یافته سر به صدها می زند و سیل انتشار این نوشته ها همچنان ادامه دارد .

این رساله نیز تلاشی در جهت معرفی و آشنایی بیشتر با این هنرمند بزرگ و نقد وبررسی آثارش می باشد . نظر من در این پایان نامه بیشتر بر بیوگرافی وزندگی نامه پیكاسو بوده ودر ادامه به بررسی دوره های نقاشی در كار او و سپس مراحل تكامل آثار وی پرداخته ام ودر نهایت مروری كوتاه بر كوبیسم وتجزیه و تحلیل این سبك كه پیكاسو بنیان گزار آن بود پرداخته‌ام. امید است با وجود ، كاستی ها و ایرادات موجود گاهی كوچك در جهت آشنایی خوانندگان عزیز با این هنرمند ودوره زندگی و آثار او برداشته باشم .

دانلود نقد و بررسی آثارپابلو پیكاسو در فایل ورد (word)
فهرست مطالب:

مقدمه

فصل اول

بیوگرافی و زندگی‌نامه پیكاسو

1

5

فصل دوم

دوره نقاشی های پیكاسو

46

دوره آبی

47

دوره صورتی

51

كوبیسم تحلیلی

54

كوبیسم تركیبی

56

فصل سوم

مراحل تكامل كار پیكاسو

60

فصل چهارم

تحلیلی بر كوبیسم

70

سالشمار زندگی پیكاسو

82

چكیده

88

دانلود نقد و بررسی آثارپابلو پیكاسو در فایل ورد (word)
فهرست منابع و مآخذ

91

برای دریافت پروژه اینجا کلیک کنید

دانلود جزوه تکنولوژی مواد غذایی رشته مهندسی صنایع غذایی در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

توجه : این فایل به صورت فایل PDF (پی دی اف) ارائه میگردد

 دانلود جزوه تکنولوژی مواد غذایی رشته مهندسی صنایع غذایی در فایل ورد (word) دارای 498 صفحه می باشد و دارای تنظیمات و فهرست کامل در PDF می باشد و آماده پرینت یا چاپ است

فایل پی دی اف دانلود جزوه تکنولوژی مواد غذایی رشته مهندسی صنایع غذایی در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل مي باشد و در فايل اصلي دانلود جزوه تکنولوژی مواد غذایی رشته مهندسی صنایع غذایی در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود جزوه تکنولوژی مواد غذایی رشته مهندسی صنایع غذایی در فایل ورد (word) :

توضیحات محصول: کتاب های آمادگی آزمون کارشناسی ارشد رشته مهندسی صنایع غذایی – ویژه کنکور سال 95

تکنولوژی روغن
ویژگیهای روغنهای نباتی خوراکی
روغن تخم پنبه
این روغن به دلیل اینکه اسیدهای لینولئیک، اولئیک و پالمتیک بیش از 90% از اسیدهای چرب آن را تشکیل مـیدهنـد
در گروه اولئیک- لینولئیک قرار میگیرد. در بین تریگلیسریدهای تشکیلدهنده این روغن تریگلیسـرید SLL (اشـباع
شده- لینولئیک- لینولئیک) تریگلیسرید غالب میباشد که بیش از %22 مولکولهای تریگلیسرید را تشکیل میدهد.
ترکیبات غیرگلیسریدی روغن تخم پنبه
روغن تخم پنبه خام دارای انواع زیادی از مواد غیرگلیسریدی است که بهوجود آورندهی رنگ قهوهای- قرمز شدید و بـوی
خاص در این روغن میباشند. همچنین در روغن خام پنبهدانه مقدار قابل ملاحظهای رافینوز و پنتوزان وجود دارد. برخی
از ترکیبات غیرگلیسریدی مهم در این روغن خام عبارتند از:
گوسیپول: این ماده یک ترکیب ترپنوئیدی سمی موجود در تخم پنبه میباشد کـه مقـداری از آن در حـین فـرآوری دانـه تحت تأثیر حرارت و رطوبت به قسمت پروتئین مغزدانه متصل میشود و بقیه آن وارد روغن جدا شده میشود کـه ایجـاد یک رنگ شدید قرمز تا قهوهای تیره در روغن خام میکند. این ترکیب توسط تصفیه قلیایی بهطـور کامـل از روغـن خـام جدا میشود.

باید گفت که بیشتر رنگ قرمز موجود در روغن تخم پنبه از باقیمانده گوسیپول و مشـتقات آن بخصـوص
گوسیپورپورین میباشد.
نکته: برای جداسازی گوسیپول از روغن تخم پنبه از اتر، استن و بوتانول استفاده میشود.
نکته: روغن تخم پنبه وقتی تا درجات بالا حرارت داده میشود تیره رنگ شده و رنگ ثابت حاصل بوسیله تصـفیه قلیـایی
یا خاك رنگبر از روغن خارج نمیشود.
توکوفرولها: توکوفرولهای روغن تخم پنبه خام در حدود 1000ppm بوده و در هنگام تصفیه تـا یـک سـوم آن ممکـن است از بین برود.
مرحلهی بیبو کردن توکوفرولها را از روغن خارج میکند.
نکته: گاماتوکوفرول، توکوفرول غالب در روغن تخم پنبه دانه میباشد.
واکنش هالفن
اسیدهای سـیکلوپروپنوئید موجـود در روغـن تخـم پنبـه نظیـر اسـید اسـترکولیک بـا گـوگرد موجـود در محلـولهـای
دیسولفیدکربن در آمیل الکل (50:50) واکنش داده و رنگ قرمز آلبالویی ایجاد میشود. این آزمایش بـرای نشـان دادن
وجود روغن تخم پنبه بسیار حساس میباشد.
روغن سویا
این روغن بالاترین سهم را در تولید روغنهای نباتی در جهان دارد. این روغن در محدوده نسبتاً وسیع حرارت بـهصـورت
مایع بوده و ترکیبات غیراشباع آن زیاد است. وجود مقدار نسبتاً زیاد (%7-8) اسید لینولنیـک پایـداری روغـن در مقابـل
اکسیداسیون را کاهش داده و برگشت طعم و بوی روغن پس از تصفیه و بیبو کردن را به لینولناتها نسبت میدهند. در
مقایسه با سایر روغنهای نباتی مقدار فسفاتیدها نیز در روغن سویا زیاد است (در حدود %2) که باید توسط صمغگیری و
تصفیه از روغن خارج شود. صمغهای بازیابی شده منبع خوبی از لسیتین تجارتی میباشند. بهدلیل وجود مقداری زیـادی
اسیدهای غیراشباع در روغـن سـویا تقریبـاً تمـام مولکـولهـای گلیسـرید حـداقل دو اسـید چـرب غیراشـباع داشـته و
گلیسریدهای با دو سه اسید چرب اشباع شده اساساً وجـود ندارنـد. فـرم تـریگلیسـرید مناسـب در ایـن روغـن UUU
میباشد که حدود %58/4 تریگلیسریدهای موجود در این روغن دارای این فرم میباشند.
مواد غیرقابل صابونی روغن سویا
بخش مواد غیرقابل صابونی روغن سویا دارای چندین ترکیب از جمله استرولهای گیاهی وتوکوفرولهاست که بـه مقـدار«20» صنایع غذایی

کم وجود داشته و دارای ارزش تجارتی هستند
روغن آفتابگردان
ویژگیهای روغن آفتابگردان که آن را برای استفاده در سسهای سالاد، محصولات نانوایی، طباخی و سرخ کردن مناسب
کرده است عبارتند از: (1) رنـگ زرد روشـن، شـفاف و طعـم مطلـوب ایـن روغـن (2) نقطـه دود ایـن روغـن در حـدود
232 2/ Co
بوده (بالاتر از سایر روغنهای مشابه) و این یکی دیگر از محاسن این روغن برای کاربرد در سرخ کردن مـواد
غذایی است. روغن آفتابگردان دارای بالاترین مقدار آلفاتوکوفرول در بین روغنهای خوراکی معمول است.
روغن آفتابگردان در حدود %15 اسیدهای چرب اشـباع و %85 اسـیدهای چـرب غیراشـباع مـیباشـد. اسـیدهای چـرب
غیراشباع آن شامل اسیدهای چرب دارای یک پیوند غیراشباع (اسید اولئیک) و درصد بالایی از اسـید چـرب دارای چنـد
پیوند غیراشباع (لینولئیک) است.

Pdfنوع فایل:

سایز: 4.36mb

تعداد صفحه:498

برای دریافت پروژه اینجا کلیک کنید

دانلود بررسی پرورش شترمرغ در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی پرورش شترمرغ در فایل ورد (word) دارای 17 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی پرورش شترمرغ در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی پرورش شترمرغ در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی پرورش شترمرغ در فایل ورد (word) :

دانلود بررسی پرورش شترمرغ در فایل ورد (word)

پرورش شتر مرغ

مطابق جدول زمانی ارائه شده با خرید 2 قطعه شتر مرغ نر و 5 قطعه شتر مرغ ماده و خرید 10 قطعه شتر مرغ یك ساله و خرید 125 تخم شتر مرغ فعالیت پرورشی شروع شده و در سال اول تعداد شتر مرغ های مولد را افزایش می دهیم تا بتوانیم ظرفیت مزرعه را به 200 قطعه برسانیم ، كه در نهایت در پایان سال پنجم مزرعه به ظرفیت كامل می رسد .

پرورش شتر مرغ دارای مراحلی به قرار زیر است :

1- خرید شتر مرغ های مولد و یكساله و تخم تشر مرغ

2- ایجاد تأسیسات و ساختانهای جهت نگهداری شتر مرغ

3- ایجاد مزرعه شتر مرغ جهت تغذیه شتر مرغ ها

1- شتر مرغ های خریداری شده برای شروع كار :

ردیف

نوع شتر مرغ ها

تعداد

1

شتر مرغ بالغ نر

2

2

شتر مرغ بالغ ماده

5

3

شتر مرغ یكساله

10

4

تخم شتر مرغ

125

سال شروع (1384 )

با توجه به 5 ماده مولد خریداری شده كه هر كدام 60 عدد تخم می گذارند و 125 عدد تخم شتر مرغ خریداری شده و همچنین در نظر گرفتن 60 الی 70 درصد قدرت باروری ، متوسط 85 درصد و 20 درصد تلفات جوجه ، 324 جوجه خواهیم داشت كه از این تعداد 160 عدد جوجه ماده و 160 عدد جوجه نر می باشند .

پایان سال 1384

در پایان سال 1384 تعداد شتر مرغ ها بر اساس جدول زیر می باشد .

ردیف

نوع شتر مرغ ها

تعداد

1

شتر مرغ بالغ نر

2

2

شتر مرغ بالغ ماده

5

3

شتر مرغ یكساله

290

4

جوجه یكروزه

300

فروش از سال 1384

با توجه به تولید و جهت بدست آوردن قسمتی از سرمایه گذاری مطابق جدول فروش زیر را خواهیم داشت .

ردیف

نوع

كل

جهت فروش

باقی مانده

1

جوجه یكروزه

300

200 قطعه

100 قطعه

2

شتر مرغ یك ساله

290

250 قطعه

40 قطعه

سال اول 1385

تعداد بالغین ما با توجه به خریداری 7 قطعه شتر مرغ بالغ در سال قبل و خریداری 1 قطعه شتر مرغ نر و 4 قطعه شتر مرغ ماده ، تعداد شتر مرغ های بالغ در این سال به 12 قطعه خواهد رسسید (3 قطعه نر و 9 قطعه ماده ) كه با این شرایط تا پایان سال 1385 انتظار تولید زیر را خواهیم داشت .

پایان سال 1385

تعداد شتر مرغ ها بر اساس جداول زیر می باشد .

ردیف

نوع شتر مرغ ها

تعداد

1

شتر مرغ بالغ نر

3

2

شتر مرغ بالغ ماده

9

3

شتر مرغ یكساله

100

4

جوجه یك روزه

540

فروش از سال 1385

با توجه به تولید و جهت به دست آوردن قسمتی از سرمایه گذاری مطابق جدول فروش زیر را خواهیم داشت .

ردیف

نوع

كل

جهت فروش

باقی مانده

1

جوجه یكروزه

540

400 قطعه

140 قطعه

2

شتر مرغ یك ساله

100

50 قطعه

50 قطعه

سال دوم 1386

تعداد بالغین ما با توجه به خریداری 10 قطعه شتر مرغ یكساله ( مطابق جدول -3 ) در سال 1384 كه در سال 1386 به سن بلوغ رسیده اند و خریداری 2 قطعه شتر مرغ بالغ و 6 قطعه شتر مرغ ماده ، تعداد كل شتر مرغ های بالغ 10 نر و 20 ماده می باشد كه تا پایان سال 1386 انتظار تولید بر اساس زیر را خواهیم داشت .

پایان سال 1386

تعداد شتر مرغ ها بر اساس جداول زیر می باشد .

ردیف

نوع شتر مرغ ها

تعداد

1

شتر مرغ بالغ نر

10

2

شتر مرغ بالغ ماده

20

3

شتر مرغ یكساله

140

4

جوجه یك روزه

600

ساختمان و تاسیسات

برای نگهداری شتر مرغ ها از حصار و سایه بان ( پناهگاه ) به همراه چراهگاه مناسب می گردد . برای هر شتر مرغ بالغ 4300 متر (5 عدد چراگاه 17 هكتاری كه در هر چراگاه 39 شتر مرغ مولد نگهداری می شود) و برای شتر مرغ های پرواری حدوداً 11 متر (5 عدد چراگاه 2500 متری كه در هر چراگاه 240 شتر مرغ پرواری نگهداری می شود). همچنین در این طرح برای مولد ها بطور جداگانه محل عراضی كشت علوفه نیز در نظر گرفته شده است كه حدوداً 80 هكتار می باشد. سایبان پیش بینی شده برای 39 شتر مرغ مولد و برای پرواری ها حدوداً 240 قطعه در نظر گرفته شده است . بدهی است محوطه نگهداری بایستی عاری از هر گونه اشیاء براق و تیز باشد . حصار كشی ها در دو نوع شیمی و فنس ( توری ها با چشمه ریز ) با ارتفاع 5/1 تا 2 متر در نظر گرفته شده است كه نوع اول عمدتاً برای چراگاه و نوع دوم برای بهار بند استفاده خواهد شد . برای تغذیه پرنده ها از آبشخور و دان خوری ها مناسب و قابل شستشو استفاده شده است . جهت جوجه كشی محلی برای نگهداری تخم ها و دستگاه آنكوباتور ، هچر و نیز محل پرورش جوجه با تجهرزات لازم و قابلیت ضو عفونی در نظر گرفته شده است و همچنین 5 دستگاه آنكوباتور و 1 دستگاه هچر در نظر گرفته شده است . بطور كلی سطح مورد نیاز برای تاسیسات و تجهیزات همراه با سایر اماكن پیش بینی شده از قبیل ساختمان های اداری ، كارگری و نیز قرنطینه و امور بهداشتی و كشت دانه برای تغذیه ، شتر مرغ ها حدوداً 200 هكتار می باشد كه محوطه چراه گاه ها و یونجه زار ها و بهار بند ها فنس كشی می شود .

عددی 2000 : ظرفیت ستر ( 5 دستگاه 400 عددی )

عدد 400 : ظرفیت هیچر ( یك دستگاه 400 عددی )

هزینه خرید و انتقال شتر مرغ به تفکیک سال

شرح

سال شروع

سال اول

سال دوم

سال سوم

شتر مرغ بالغ

189.000.000

54.000.000

216.000.000

شتر مرغ یکساله

120.000.000

تخم شتر مرغ

50.000.000

هزینه قرنطینه و حمل شتر مرغهای بالغ

35.000.000

25.000.000

40.000.000

هزینه قرنطینه و حمل شتر مرغ های یکساله

40.000.000

هزینه حمل تخم شتر مرغ ها

5.000.000

جمع

439.000.000

79.000.000

256.000.000

برای دریافت پروژه اینجا کلیک کنید

دانلود مجموعه تست زبان تخصصی صنایع غذایی در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

توجه : این فایل به صورت فایل PDF (پی دی اف) ارائه میگردد

 دانلود مجموعه تست زبان تخصصی صنایع غذایی در فایل ورد (word) دارای 263 صفحه می باشد و دارای تنظیمات و فهرست کامل در PDF می باشد و آماده پرینت یا چاپ است

فایل پی دی اف دانلود مجموعه تست زبان تخصصی صنایع غذایی در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل مي باشد و در فايل اصلي دانلود مجموعه تست زبان تخصصی صنایع غذایی در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود مجموعه تست زبان تخصصی صنایع غذایی در فایل ورد (word) :

توضیحات محصول: کتاب های آمادگی آزمون کارشناسی ارشد رشته مهندسی صنایع غذایی – ویژه کنکور سال 95 – همراه تست ها و پاسخ تشریحی

مجموعه تست
A complete flower, such as we find in buttercups, lilies and geraniums, is also called a
perfect, or bisexual flower, because it has both stamens, or male elements, and pistils
or female elements.
1- According to the text, a complete plant is the one which ……. .
1) is a subfamily of buttercups
2) has both female and male elements
3) has no stamens but in has pistils
4) has no pistils but it has stamens
From the archaeological evidence, southwestern Asia-including most of what is now
called the Middle East-seems to have been the earliest agricultural focus. This region
was the homeland of wheat and barley and of the chief old World domestic animals
and the site of the invention of the plow.
2- The text implies that ……. in the Middle East for the first time.
1) barley and wheat were cultivated
2) all inventions were developed
3) old domestic animals were never used
4) archaeological excavations were conducted«6» مجموعه صنایع غذایی
For a long time breeders and scientists have tried to make new varieties of animals
and plants appear with greater frequency than by nature”s slow mutation rate. The
most successful known method used to produce mutation is by radiation.
3- Although many methods have been developed to accelerate the planting
growth, the …….. bas proven to be more effective.
1) atomic method 2) scientific method
3) slow mutation 4) frequent reproduction
The leaves of most ofthe perennial broadleaved trees are shed in the fail.In certain casesleaves
are shed more or less continuously throughoutthe year. Each leaf falls after it reaches a certain
age,whichmay range from one year to five, depending on the species.
4- One tends to understand from the above text that leaves …….. .
1) fall only in the fall
2) of certain species fall in the fall
3) fall only when their lives are over
4) of all trees fall once a yearزبان تخصصی «7»
The leaves of carnivorous plants trap hold and digest insects and other small animals.
Carnivorous plants are found chiefly in bogs, sandy areas and tropical rain forests. In
such areas nitrogen and various other essential food elements are likely to be present
only in small amounts.
5- According to the text, carnivorous plants live on ……. .
1) tropical plants
2) tiny animals
3) plants with nitrogen in their structures
4) digestible food elements in sandy areas
پاسخنامه
یک گل کامل مانند آنچه که در گلهای آلاله، یاس و شمعدانی میبینیم، از نظر جنسـی کامـل و یـا دو جنسـی نامیـده
میشود زیرا دارای بخشهای پرچم مذکر و بخشهای مادگی یا مؤنث میباشد.
1. با توجه به متن، گیاه کامل گیاهی است که ……
1) زیر شاخه آلاله باشد.
2) هر دو بخش مادگی یا مذکر را داشته باشد.
3) پرچم نداشته باشد اما مادگی داشته باشد.
4) مادگی نداشته باشد اما پرچم داشته باشد.

از نظر شواهد باستانشناسی جنوب غربی آسیا شامل اکثر بخشهایی است که امروزه خاورمیانه نامیده میشود و به نظـر
میرسد که بر ابتداییترین سطح کشاورزی متمرکز شده است. این ناحیه موطن گندم وجود عمده حیوانات اهلی قـدیمی
جهان و محل اختراع گاوآهن بود.
2. متن بیان میدارد که …………….. در خاورمیانه برای اولین بار.
1) گندم و جو درو میشود. 2) تمام اختراعات توسعه پیدا کرد.
3) حیوانات اهلی قدیمی به کار گرفته نمیشد. 4) حفاری کشاورزی اجرا میشد.

از زمانهای خیلی طولانی متخصصان اصلاح نژاد و دانشمندان سعی کردهاند تا گونههای جدیـدی از حیوانـات و گیاهـان
که با فرکانس بیشتر از نظر سرعت جهش کنند و به وسیله طبیعت ظاهر میگردند را تولید کنند موفقیتآمیزترین روش
مورد استفاده به منظور تولید جهش یا موتاسیون، جهش ایجاد شده به وسیله تشعشع است.
3. اگر چه روشهای زیادی برای شتاب بخشیدن به رشد گیاهان توسعه پیـدا کـرده اسـت …………. بـه نظـر
میرسید مؤثرترین باشد.
1) روش اتمی 2) روش علمی
3) جهش کند 4) اغلب تولید دوباره
«18» مجموعه صنایع غذایی
برگهای اکثر درختان برگ پهن دائمی در فصل پاییز ریخته میشوند. در موارد خاص ریزش برگها کم و بیش بـه طـور
پیوسته در سرتاسر سال ریزش میکنند هر برگ بعد از اینکه آن به سن معینی میرسید میریـزد کـه ایـن سـن ممکـن
است از یک تاب پنج سال نوسان کند که بستگی به گونه آن دارد.
4. میتوانیم از متن بفهمیم که برگها ………
1) در فصل پاییز تنها میریزد.
2) گونههای اصلی در فصل پاییز میریزند.
3) تنها هنگامی میافتند که برگهایشان به سن معینی برسد.
4) برگهای همه درختان یکبار در سال میریزد.

برگ گیاهان گوشتخوار، حشرات و دیگر حیوانـات کوچـک را بـه دام انداختـه، نگـه داشـته و هضـم مـیکننـد. گیاهـان
گوشتخوار عمدتاً در نواحی شنی و با تلاقی و جنگلهای باران مناطق استوایی یافت میشوند. در چنین مناطقی نیتروژن
و دیگر عناصر غذایی ضروری متعدد احتمالاً فقط در مقادیر کم یافت میشوند.
5. با توجه به متن، گیاهان گوشتخوار در ……………. زندگی میکنند.
1) نواحی گرمسیری 2) حیوانات کوچک
3) گیاهان با نیتروژن در ساختارشان 4) عناصر غذاهای قابل هضم در محیطهای شنی

اندامهای رویشی، ریشهها، ساقهها و برگها برای انسان حائز اهمیت هستند. آنها به رشد میوهها و دانهها کـه میـوههـا و
دانه ها را ما به عنوان غدا استفاده میکنیم و همچنین برای اهداف پزشکی و صنعتی به کار میبریم کمک مـیکننـد. امـا
این فقط یک بخشی از داستان است. اندامهای رویشی خودشان در روشهای بسیار گوناگونی به درد ما میخورند که مـا
فقط یک بخش کوچکی از کارهایشان را در اینجا میتوانیم دانلود مجموعه تست زبان تخصصی صنایع غذایی در فایل ورد (word)
فهرست کنیم.

Pdfنوع فایل:

سایز: 4.00mb

تعداد صفحه:263

برای دریافت پروژه اینجا کلیک کنید

دانلود بررسی راه‌كارهای مقابله با آنفلونزای طیور در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی راه‌كارهای مقابله با آنفلونزای طیور در فایل ورد (word) دارای 14 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی راه‌كارهای مقابله با آنفلونزای طیور در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی راه‌كارهای مقابله با آنفلونزای طیور در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی راه‌كارهای مقابله با آنفلونزای طیور در فایل ورد (word) :

بررسی راه‌كارهای مقابله با آنفلونزای طیور

مقابله با آنفلوانزای طیور

مقدمه:

آنفلونزای طیور (طاعون طیور یا فلور پرنده) بیماری بالقوه بسیار مخربی بوده كه غالباً در جوجه ها، بوقلمونها، اردكها و غازها تظاهر می كند، گرچه تعداد بسیار زیادی از گونه های دیگر پرندگان ممكن است آلوده و بصورت یك ناقل تبدیل گردند. در 84-1983 شیوع بیماری در پنسیلوانیای آمریكا باعث مرگ و كشتار بیش از 20 میلیون پرنده گردید. شیوع بیماری در ایتالیا در ماه می سال 2000 باعث مرگ بیش از 14 میلیون پرنده شد. شیوع اخیر بیماری در آسیا تاكنون 12 كشور را در منطقه از اواخر سال 2003 تا كنون آلوده نموده است كه آمار تلفات و زیانها در حال محاسبه می باشد.

بیماری

بیماری آنفلوانزای طیور در اثر یك ویروس آنفلوانزا می تواند ایجاد گردد. ویروس این گروه از لحاظ شدت بسیار گسترده اند. برخی سویه ها (بخصوص سروتیپهای H7 , H5 ) بسیار بیماریزا و مسری بوده كه قادر به ایجاد مرگ و میر به میزان بیش از 90 درصد در برخی گله ها می گردند. عفونت توسط سویه H5N1 موردی است كه اخیراً در آسیا به انسان سرایت نموده و تعداد بسیاری را آلوده نموده است. با عفونت ویروسی بسیار حاد علائم كلنیكی ممكن است بصورت مرگ و میر بالا ناگهانی، احتمالاً با شروع تب و یا دپرس شدن شدید ظاهر یابد. علائم التهاب مخاط چشم، حركت سریع چشمها، التهاب سینوسها و سر سیانوزه متورم ممكن است در پرندگان مبتلا مشاهده گردد. شكل خفیفتر بیماری ممكن است بصورت علائم تنفسی غیر اختصاصی تظاهر كند. در گله های مادر و تخمگذار علائم بصورت كاهش شدید و ناگهانی تولید یا افزایش تعداد تخم مرغهای پوست نازك و نرم (لمبه) بروز نماید.

انتشار بیماری

پرندگان مهاجر بخصوص پرندگان آبزی، عمده ترین منابع ویروسهای آنفلونزا محسوب گردید كه موجب شروع شیوع گسترده بیماری در آسیا گردیده اند. پرندگان مهاجر با توجه به رفتار مهاجرتی آنها از طریق مدفوع، قادر به انتقال و انتشار ویروسها بطور گسترده از منطقه كشور یا قاره ای به منطقه دیگر می باشند و شیوع بیماری غالبا در نزدیكی مسیرهای مهاجرتی آنها اتفاق می افتد. پرندگانی كه مسیرهای طولانی پرواز می كنند، خسته و تحت استرس بوده و دفع ویروس در این هنگام به دلیل جستجو برای منابع غذایی در مكانهای طیور تجاری افزایش یافته و در این مواقع احتمال آلودگی پرندگان تجاری فزونی می یابد.

انتشار آلودگی به پرندگان منطقه اغلب از طریق آلودگی به وسیله مدفوع پرندگان آلوده رخ می‌دهد. تماس مستقیم با مدفوع توسط پرندگان یا انتقال بصورت غیر مستقیم از طریق پرسنل و تجهیزات به فارمهای طیور از مهمترین راههای انتقال عامل بیماری محسوب می گردد. انسان مسلما مهمترین راه انتقال بیماری در داخل مناطق تولید طیور می باشد. پرسنل از طریق لباس، چكمه، وسایل و دستها، ویروس را از یك سالن به سالن دیگر منتقل می نمایند. حشرات و جوندگان ممكن است بعنوان ناقلین مهم منطقه ای عمل نمایند. حركت در داخل منطقه پرورش طیور می تواند بسرعت از طریق ذیل صورت پذیرد:

1- تجهیزات حمل مواد غذایی

2- انتقال پرندگان بیمار و مرده

3- سرنگهای واكسیناسیون

4- وسایل جمع آوری مرغ

5- مهندسین

6- دامپزشكان

7- رفت و آمد كارگری

نتیجه گیری

بیماری ‌آنفلونزای طیور بیماری بسیار خطرناكی بوده كه قادر خواهد بود منطقه را كاملاً و تولید پرورش طیور را در آن یكی از مهمترین منابع سوریه H5N1 ویروس آنفلونزای طیور، پرندگان وحشی بخصوص اردكهای وحشی بوده كه نسبت به ویروس بسیار مقاومند. این گونه پرندگان مقاومترین گونه ها به این ویروس می‌باشند. پرندگان اهلی از قبیل مرغ و بوقلمون نسبت به فرم حا همه گیری كشنده ویروس بسیار حساسند. تماس مستقیم و یا غیر مستقیم پرندگان اهلی با پرندگان آبزی مهاجر، عمده ترین علت شیوع و اپیدمیك شدن بیماری آنفلونزای طیور می‌باشد. پرندگان زنده موجود در بازار از دیگر دلایل عمده شیوع بیماری محسوب می گردند. در مناطقی كه مشكل شیوع بیماری گزارش می گردد، مهمتری اتفاق كاهش تقاضا برای محصولات گوشت و تخم مرغ، علی رغم اطمینان دولتی خواهد بود كه مسلما پیامدهای جبران ناپذیری را برای صنعت پرورش طیور در آن منطقه به دنبال خواهد داشت.

كلمه استرس در صنعت طیور عموما برای توصیف اثرات مجموعه ای از حالات یا وضعیتهای غیر اختصاصی دارای تعریف مهم، استفاده می گردد. استرس اغلب به عنوان یك تشخیص جایگزین پذیرفته می شود، به خصوص زمانیكه تشخیص روشن و واضحی وجود نداشته باشد و یا هیچ نوع درمانی یا كار تشخیصی شناخته شده‌ای

در برطرف كردن مشكل، موثر واقع نشده باشد. صرف نظر از میزان درك ما از استرس، این امر پذیرفته شده است كه استرس فیزیولوژیكی عاملی اساسی در صنعت مرغداری است و فاكتورهای اقتصادی مهمی همچون میزان رشد، پاسخ ایمنی، ضریب تبدیل، باروری، قابلیت هچ و سرزندگی جوجه ها را تحت تأثیر سوء قرار می‌دهد.

اصولاً استرس پاسخ فیزیولوژیكی جوجه ها است به تحریك یا احتیاجات خارجی كه نیاز به تطبیق جهت بقاء فوری و یا سازگاری جهت بقاء طولانی مدت دارند این پاسخ فیزیولوژیكی به آزاد سازی انرژی و مصرف آن نیازمند است. بنابراین در تمام استرس های فیزیولوژیكی، مواد غذایی و ذخایر بدن بجای مصرف در جهت بهبود پارامترهای اقتصادی مهم صرف فعالیتهای فیزیولوژیكی ضروری برای بقاء فوری می گردد.

برای دریافت پروژه اینجا کلیک کنید

دانلود بررسی شاخه نرمتنان در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی شاخه نرمتنان در فایل ورد (word) دارای 14 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی شاخه نرمتنان در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی شاخه نرمتنان در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی شاخه نرمتنان در فایل ورد (word) :

دانلود بررسی شاخه نرمتنان در فایل ورد (word)

شاخه نرمتنان (Phylum Mollusca)

اعضای شاخه نرمتنان بدن نرم و بدون تقسیمی دارند. معمولاً سر آنها در قسمت جلو است و یك پای شكمی و توده‌ احشایی پشتی نیز در بدن آنها وجود دارد. بدنشان كم و بیش از یك روپوش (Mantle) نازك احاطه شده است اغلب در یك صدف آهكی خارجی محفوظ اند. این شاخه از پنج رده تشكیل میگردد كه از لحاظ ظاهر، طرز زندگی و رشد با یكدیگر اختلاف دارند.

1- رده دو عصبیها مانند كیتونها

2- رده ناوپایان مانند دنتالیوم

3- رده شكمپایان مانند حلزونهای صدفدار و بی‌صدف.

4- رده تبرپایان مانند صدفهای خوراكی دو كفه‌ای

5- رده سرپایان مانند نوتیلیها

6- اسكوئیدها ، هشتپایان و غیره

فسیل شناسی نرم تنان:

یكی‌ از مهمترین بخش های بی‌مهرگان خصوصاً از نظر مطالعه فسیل شناسی نرم تنان است. نرم تنان در دریا، آبهای شیرین، دریاچه‌ها و بالاخره خشكی زندگی می‌كند.

نام نرمتنان اصولاً برای انواع به كار برده شده كه قسمت سخت ندارند و لذا به دو دسته تقسیم شدند: دسته‌ای دارای قسمت سخت و دسته‌دیگر بدون قسمت سخت می باشند.

اساسی تقسیم بندی جدید به وسیله‌ دانشمندی فرانسوی پایه گذار شد و او بر اساس شباهت قسمتهای نرم و قسمتهای سخت، نرم تنان را به سه رده تقسیم بندی كرده كه عبارتند از: گاستروپودار، سفالوپودا و دو كفه‌ای‌ها .

صور مشخصه نرم تنان عبارت است از:

1- عدم بند بند بودن بدن

2- تقارن ارگانیسم بدن نسبت به یك صفحه

3- مركزیت عضو حساس در سر (به استثناء پلسی پودا)

4- پوشیده شدن بدن به وسیله پوست

5- خواص اختصاصی دستگاه گوارش و سیستم عصبی

6- صور مشخص در حالات لاروی

پوست دارای سلول‌هایی است كه غشاء را ترشح می‌كند. غشاء در كلیه نرم تنان از كربنات كلسیم ساخته شده و تمام یا قسمتی از آن به صورت كلیست یا آراگونیت است. معمولاً غشاء خارجی گاهی كاملاً داخلی است.

رده گاستروپودا: بدن معمولاً در یك غشاء مارپیچ غیرمتقارن قرار دارد. سر مشخص و دارای یك یا دو زوج Tentacle و یك زوج چشم است. پا عریض و مسطح است ولی در انواع شناگر به شكل بال مانندی در می‌آید.

رده شكم پایان

رده شكم پایان بزرگ‌ترین و متنوع‌ترین گروه از نرم تنان است و دربرگیرنده بعضی از ابتدایی‌ترین نرم تنان (بعضی از شكم پایان دریازی) و بعضی از تكامل یافته‌ترین آن ها (بعضی شكم پیان خشكی زی) است. صدف این جانوران یك تكه و معمولاً مخروطی شكل است كه توده‌ احشایی را احاطه كره است. سر و پای عضلانی معمولاً تقارن دو طرفی دارد ولی این تقارن به علت پنج خوردن توده احشایی، در توده احشایی به چشم نمی خورد.

شكم پایان از طریق جلد (جبه) و یا حفره جبه كه نقش شش را بازی می كند، تنفس می‌كند. جداش و یا تك جنس و هر مافرودیت هستند و در عده‌ای چرخه زندگی مستقیم است.

در شكمپیان (به یوننی Gaster = شكم + Podos= پا) سر كه در قسمت جلو بدن است، پای شكمی، كه طویل است تقارن دو جانبی دارد. توده احشایی معمولاً درون یك صدف پشتی جای میگرد و هر دو بطور مارپیچی پیچیده و غیر متقارن میباشد. سر توده كم و بیش استوانه‌ای شكلی است كه بدون آنكه از بقیه‌ بدن مشخص باشد بطرف جلو ادامه دارد. بر روی سر زواید حسی موجود است كه شاخك نامیده میشود و بر حسب نوع حیوان متفاوت میباشد. دهان در انتهای قدامی بدن واقع است و در داخل دهان زبانه‌كوچكی وجود دارد بنام سوهانك. در این عضو دندانهایی وجود دارد كه تعدادش در انواع مختلف متفاوت است و در بعضی نمونه‌ها بالغ بر چندین هزار است.

چین خوردگی پوست بدن یا روپوش حفره وسیعی را تشكیل می دهد كه آنرا حفره روپوشی مینامند.

دستگاه دم زدن، مجرای مواد دفعی و مجرای دستگاه تناسلی، در حفره روپوشی قرار دارد.

در شكمپایان اجدادی شاید در همه قسمتها تقارن دو جانی وجود داشته است.

ولی در گونه‌های زنده قرینه دو طرفی كامل از بین رفته است زیرا بدن جانور در حول محوری كه از رأس صدف عبور مینماید 180 درجه یا كمتر دوران حاصل نموده است و در اثر این دوران حفره روپوشی در نزدیك سر جانور قرار گرفته است.

شكمپایان معمولاً دارای یك جفت چشم هستند كه بر روی سر و احیاناً در انتهای قدامی بدن روی شاخكها قرار گرفته ‌است.

حلزون باغی:

نام علمی حلزون معمولی كه در باغ‌ها به چشم می‌خورد Helixaspersa است.

موجود فعال از نظر ظاهری یك قسمت پایی- سری دارد كه سر در جلویی ترین بخش آن واقع است و با دو جفت شاخك (جفت اول حسی و جفت دوم چشمی) از بقیه قسمت‌های آن متمایز است. دهان كه یك منفذ شكاف مانندی است و دست زیر حد جلویی پایی – سری واقع است، چندان مشخص نیست. پای عضلانی كه دارای تقارن دو طرفی است مرز مشخصی با سر ندارد. توده احشایی مركب از امعاء و احشاء پیچ خورده، توسط یك صدف یك تكه‌ مارپیچ احاطه شده است.

جبه پوشاننده توده‌ احشایی در حاشیه پائینی كمی ضخیم‌تر است (جز در یك نقطه به نام منفذ و یا به نوموستوم كه در سمت راست بدون قرار دارد) و یقه‌ جبه نامیده می‌شود. در محل نوموستوم جبه با دیواره ‌بدن اتصال ندارد و حفره جبه كه یك دیواره عروقی دارد و هوادار است. از فاصله گرفتن جبه از دیواره‌ بدن ایجاد شده است. این حفره نقش ریه یا شش را برای جانور بازی می كند؛ عروق دیواره‌ حفره به كمك هوا، اكسیژنه می‌شوند. اكسیژن به قلب می رسد و توسط سرخرگ ها به دیگر نقاط بدن انتقال می‌یابد. خون تیره نیز به قلب باز می گردد و از قلب به حفره جهت تبادل جریان می‌یابد.

منفذ تناسلی كوچك است و در نزدیكی پایه شاخك چشمی در سمت راست قرار دارد. تنها منفذ اداری و مخرج به می‌شوند و موقعیت آن‌ها به این ترتیب است كه مخرج كمی عقب منفذ ریه و منفذ اداری كمی بالای مخرج قرار دارد.

در این جانور جز منفذ ریه، منفافذ اداری و مخرج از بیرون نمایان نیستند.

برای دریافت پروژه اینجا کلیک کنید

دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word) دارای 149 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word) :

بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران

خلاصه:

در كشورهای در حال توسعه, آلودگی مواد غذائی و بیماربهای ناشی از آن همواره به عنوان یكی از مهمترین مشكلات در سیستم بهداشت مواد غذائی بشمار می آید.

اگرچه در كشور ما ارتقاء سطح بهداشت عمومی در نتیجه بهبود نظام عرضه خدمات بهداشتی باعث كاهش میزان مرگ و میر در سالهای اخیر شده است, با این وجود پی آمدهای نامطلوب تغذیه ای و بهداشتی ناشی از آلودگی مواد غذائی با عواقب زیانبار اقتصادی همراه می باشد.

علت مهم ایجاد مسمومیت و بیماریهای روده ای, مواد غذائی می باشد, یكی از این مواد غذائی كه از نظر آلودگی اهمیت به سزائی دارد, شیر و فراورده های آن نظیر بستنی است. بستنی بخصوص در فصول گرم دارای مصرف كننده بسیاری می باشد و در مورد این ماده غذائی باید از نظر بهداشتی نظارت كامل صورت گیرد. به منظور بررسی آلودگی باكتریائی در بستنی های سنتی ومیوه ای( غیر پاستوریزه) و بستنی های پاستوریزه, تعداد 100 نمونه بستنی غیرپاستوریزه و 30 نمونه بستنی پاستوریزه از قسمتهای مختلف شهر تهران بصورت
Random Systematic Samplingجمع آوری شد كه پس از انجام آزمایشات در آزمایشگاه كنترل كیفی مواد غذائی, آرایشی و بهداشتی واقع در مركز فایلات علوم پزشكی ایران, 87 درصد از نمونه های غیر پاستوریزه فیرقابل مصرف و باكتریهای موخود در آنها به ترتیب فراوانی عبارت بودند از:

استافیلوكوك اورئوس(74%), گونه های كلبسیلا(40%), گونه های انتروباكتر(37%), اشریشیا كلی(24%),سودوموناس آئروجینوزا(19%),گونه های پروتئوس(13%), گونه های اسینتوباكتر(11%), هافنیا(6%), گونه های آلكالی ژنز(4%), گونه های سراتیا(3%),گونه های سیتروباكتر و ادواردسیلا(2%) و گونه های پروویدنسیا(1%).

و در بستنی های پاستوریزه, 30 درصد از نمونه ها غیر قابل مصرف بودند و باكتریهای موجود در آنها به ترتیب فراوانی عبارت بودند از:

اشریشیا كلی(4/13%), استافیلوكوك اورئوس(7/6%), كلبسیلا نومونیه(7/6%), سودوموناس آئروجینوزا, پروتئوس ولگاریس, انتروباكتر كلواكه و اسینتوباكتر بامانی(3%).

برای بررسی لیستریا و یرسینیا از محیط های اختصاصی Palcam , CiN و غنی سازی در سرما(Cold enrichment ( استفاده شد ولی علی رغم تلاشهای بسیار موفق به جداسازی نشدیم.

مقدمه:

صنایع غذایی همگام با صنایع و تكنولوژی جدید هر روز به صورت چشمیگری گسترش می یابد. ولی با وجود این پیشرفت سریع در صنایع غذایی و كنترل بهداشتی آن شاهد موارد متعددی مسمومیت ناشی از مواد غذایی هستیم. مسمومیت های غذایی و عوارض آن یكی از مشكلات اساسی تمام جوامع می باشد. این موضوع حتی در كشورهای پیشرفته دنیا نیز به میزان زیادی دیده می شود.

از این رو افزایش بیماریهای ناشی از مواد غذایی بسیار نگران كننده تلقی می شود و علیرغم تلاش و پیگیری های دست اندركاران هنوز میزان اندكی از بیماریهای حاصله از آلودگی غذاشناسایی شده اند. عوامل مهم درآلودگی مواد غذایی نوع غذا و اجزای متشكله آن می باشد. بدین صورت كه هر چه ارزش غذایی مواد خوراكی بیشتر باشد و یا نگهداری آن شرایط ویژه ای را طلب كند و نیز در ‏فرآیند تولید آن عواملی همانند میكروارگانیسم افزوده شوند عوامل متعدد غیرمدرنیزه و احتمالا آلوده دخیل باشند آلودگی ماده غذایی و خطر ابتلا به مسمومیت ناشی از آن افزایش می یابد.

یكی از پرمصف ترین مواد غذایی شیر و فرآورده های وابسته به آن است. زیرا شیر و فرآورده های لبنی در تمامی كشورهای دنیا بخشی از غذای روزانه مردم را تشكیل می دهد و به سبب مواد غنی غذایی و سهولت آلودگی شیر، از لحاظ مسمومیت غذایی نیز ماده مهمی محسوب می شود. در این میان آلودگی بستنی كه از فرآورده های شیر محسوب میشود از سه جنبه در خور توجه است، نخست آنكه مصرف بستنی كه در حقیقت یك نوع شیرینی خنك می باشد، عموما در فصل تابستان صورت می گیرد كه خطر ابتلاء آلودگی مواد غذایی در این فصل بیشتر است.

ثانیا: مصرف بستنی در بین همه مردم خصوصا كودكان شایع تر است و چون از غذاهای بسیار مطبوع و لذیذ به شمار می آید، مصرف آن به صور گوناگون نیز هر روز فزونی می یابد.

ثالثا: در تهیه بستنی از مواد مختلفی استفاده می شود كه هر كدام از آنها می توانند منشا آلودگی شده و سبب بیماری گردند. همچنین میكروارگانیسم ها می توانند بصورت ثانویه از طریق تهیه كنندگان و فروشندگان بستنی وارد آن گردند. بنابراین توجه به مسمومیت ناشی از آلودگی بستنی بخصوص در كشور ما كه در تولید آن روش های سنتی بیشتر معمول است، باید مورد توجه قرار گرفته و فایلات كافی در مورد انواع بیماریهای ناشی از آلودگی بستنی و نیز راههای آلوده شدن آن صورت گیرد.

با توجه به اهمیت این موضوع و پیشنهاد جناب آقای دكتر امیر مظفری و سركار خانم فروهش تهرانی بر آن شدم تا كار خود را روی این موضوع اّغاز كنم.

شایان ذكر است كه به علت كمبود امكانات و نیز محدود بودن نمونه های برداشت شده و تحت پوشش قرار نگرفتن تمامی مناطق تهران جهت نمونه گیری بررسی و فایل حاضر خالی از اشكال نیست.

دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word)
فهرست مطالب

عنوان صفحه

خلاصه فارسی……………………………………………………………………………………………….. 1

مقدمه:………………………………………………………………………………………………………….. 3

فصل اول: زمینه فایل و مروری بر اپیدمیهای رخ داده از شیر……………………………… 5

فصل دوم: كلیاتی در خصوص بستنی…………………………………………………………………. 18

2-1: تاریخچه بستنی……………………………………………………………………………………….. 19

2-2: تعریف بستنی…………………………………………………………………………………………. 20

2-3: ارزش غذایی بستنی………………………………………………………………………………….. 22

2-4: مواد تشكیل دهنده بستنی…………………………………………………………………………… 24

2-4-1: چربی…………………………………………………………………………………………… 24

2-4-2: مواد جامد غیر از چربی……………………………………………………………………. 25

2-4-3: قند……………………………………………………………………………………………… 27

2-4-4: مواد امولسیون كننده…………………………………………………………………………. 29

2-4-5: مواد پایداركننده………………………………………………………………………………. 29

2-4-6: مواد طعم دهنده………………………………………………………………………………. 30

2-4-7: مواد رنگ دهنده……………………………………………………………………………… 30

2-5: فرآیند تولید بستنی…………………………………………………………………………………… 30

2-5-1: مرحله دریافت……………………………………………………………………………….. 30

2-5-2: تولید مخلوط بستنی…………………………………………………………………………. 31

2-5-3: توزین كردن………………………………………………………………………………….. 32

2-5-4: مخلوط كردن…………………………………………………………………………………. 33

2-5-5: یكنواخت كردن گویچه های چربی……………………………………………………… 34

2-5-6: پاستوریزاسیون……………………………………………………………………………….. 34

2-5-7: رسیدن مخلوط……………………………………………………………………………….. 34

2-5-8: افزودن مواد طعم دهنده و رنگ دهنده………………………………………………….. 35

2-5-9: انجماد به روش مداوم……………………………………………………………………… 35

2-5-10: قالب گیری و بسته بندی…………………………………………………………………. 36

2-5-10-1: بسته بندیهای بزرگ بستنی……………………………………………………… 36

2-5-10-2: بسته بندیهای مورد مصرف خانگی……………………………………………. 37

2-5-10-3: تولید بستنی چوبی……………………………………………………………….. 37

2-5-11: سخت كردن بستنی…………………………………………………………………………. 38

2-6: باكتریولوژی بستنی…………………………………………………………………………………… 39

2-7: اپیدمیولوژی آلودگیهای میكروبی………………………………………………………………….. 40

2-7-1: آلودگیهای اولیه بستنی……………………………………………………………………… 41

2-7-2: آلودگیهای ثانویه بستنی…………………………………………………………………….. 45

2-8: پیشگیری و كنترل…………………………………………………………………………………….. 48

فصل سوم: خلاصه ای از خصوصیات عمومی و كلینیكی باكتریهای جدا شده در بستنی. 51

3-1: میكروبیولوژی پایه……………………………………………………………………………………. 52

3-2: میكروبیولوژی لبنیات………………………………………………………………………………… 52

3-3: رشد میكروبی ………………………………………………………………………………………… 54

3-4: میكروارگانیسم ها در شیر…………………………………………………………………………… 57

3-5: مشخصات میكروارگانیسم ها در شیر…………………………………………………………….. 58

3-6: میكروارگانیسم های ایجاد كننده فساد در شیر………………………………………………….. 59

3-7: میكروارگانیسم های بیماریزا در شیر……………………………………………………………… 60

3-8: باسیلهای گرم منفی بی هوازی اختیاری………………………………………………………….. 60

3-8-1: تعریف انتروباكتریاسه………………………………………………………………………. 61

3-8-2: اشریشیاكلی…………………………………………………………………………………… 63

3-8-3: گروه كلبسیلا، انتروباكتر، سراتیا………………………………………………………….. 67

3-8-4: گروه پروتئوس، مورگانلا، پروویدنسیا………………………………………………….. 69

3-8-5: سیتروباكتر…………………………………………………………………………………….. 70

3-8-6: جنس شیگلا………………………………………………………………………………….. 70

3-8-7: جنس سالمونلا……………………………………………………………………………….. 71

3-8-7-1: تشخیص سالمونلا از جنس های دیگر………………………………………… 72

3-8-7-2: آزمایشات تشخیصی……………………………………………………………… 74

3-8-7-3: پاتوژنزو یافته های بالینی………………………………………………………… 75

3-8-7-4: مواد غذایی كه بطور رایج در انتقال سالمونلا نقش دارند…………………. 77

3-9: باكتریهای گرم منفی غیر تخمیری و غیرشایع…………………………………………………… 78

3-9-1: گروه سودموناها……………………………………………………………………………… 78

3-9-1-1: سودمونا آئروجینوزا……………………………………………………………………… 78

3-9-2: یرسینیا…………………………………………………………………………………………. 79

3-9-2-1: یرسینیا انتروكولیتیكا ویرسینیاپسودوتوبركلوزیس…………………………….. 80

3-9-2-2: پاتوژنز و یافته های بالینی………………………………………………………… 81

3-9-2-3: آزمایشات تشخیصی……………………………………………………………… 82

3-9-2-4: پیشگیری و كنترل…………………………………………………………………. 825

3-10: استافیلوكوك…………………………………………………………………………………………. 82

3-10-1: استافیلوكوك اورئوس……………………………………………………………………. 82

3-10-2: مورفولوژی…………………………………………………………………………………. 83

3-10-3: ساختمان سلولی…………………………………………………………………………… 83

3-10-4: مقاومت…………………………………………………………………………………….. 84

3-10-5: خواص بیوشیمیایی……………………………………………………………………….. 85

3-10-6: مسمومین غذایی استافیلوكوكی………………………………………………………… 86

3-10-7: علائم مسمومیت غذایی استافیلوكوكی……………………………………………….. 89

3-10-8: پیشگیری وكنترل در مسمومیت غذایی…………………………………………….. 90

3-11: باسیل های گرم منفی بدون اسپور……………………………………………………………….. 91

3-11-1: لیستریامونوسیتوجنز……………………………………………………………………… 91

3-11-1-1: تاریخچه…………………………………………………………………………………… 91

3-11-1-2: میكروبیولوژی………………………………………………………………………. 91

3-11-1-3: لیستریوزیس………………………………………………………………………… 93

3-11-1-4: وقوع و رشد لیستریا در شیر و فرآورده های آن……………………………. 95

3-11-1-5: حداقل دوز عفونت زایی…………………………………………………………. 99

3-11-1-6: روش های جستجوی لیستریامونوسیتوجنز درمواد غذایی…………………. 100

3-11-1-7: پاتوژنز و ایمنی…………………………………………………………………….. 104

فصل چهارم: روشها و مواد مورد نیاز………………………………………………………………… 106

4-1: مدت مطالعه………………………………………………………………………………………….. 107

4-2: تعداد نمونه…………………………………………………………………………………………….. 107

4-3: نحوه نمونه برداری ………………………………………………………………………………….. 107

4-4: بررسی های انجام شده………………………………………………………………………………. 108

4-5: مواد و وسایل مورد استفاده ……………………………………………………………………….. 108

4-6: روش آماده سازی…………………………………………………………………………………….. 109

4-7: روش آزمایش نمونه های مواد غذایی……………………………………………………………. 109

4-8: رقیق كننده ها………………………………………………………………………………………….. 110

4-8-1: روش تهیه محلول رینگر…………………………………………………………………… 110

4-8-2: روش تهیه سرم فیزیولوژی………………………………………………………………… 111

4-8-3: روش تهیه محلول رقیق كننده آب پیتونه……………………………………………….. 111

4-9: روش شمارش میكروبها ……………………………………………………………………………. 111

4-10: شمارش و شناسایی كلی فرم ها…………………………………………………………………. 112

4-11: شناسایی اشریشیاكلی………………………………………………………………………………. 113

4-12: شناسایی سالمونلا…………………………………………………………………………………… 113

4-13: شناسایی استافیلوكوك اورئوس………………………………………………………………….. 114

4-13-1: طرز تهیه محیط كشت بردپاركر……………………………………………………………… 114

4-14: شناسایی یرسینیا…………………………………………………………………………………….. 116

4-15: شناسایی لیستریا…………………………………………………………………………………….. 117

4-15-1: محیط اختصاصی پالكام………………………………………………………………….. 118

4-16: حدمجاز میكروبی در بستنی……………………………………………………………………… 118

4-17: تستهای تشخیصی………………………………………………………………………………….. 119

فصل پنجم: نتیجه و بحث………………………………………………………………………………… 123

5-1: نتایج…………………………………………………………………………………………………….. 124

5-2: بحث…………………………………………………………………………………………………….. 138

5-3: پیشنهادات……………………………………………………………………………………………… 146

خلاصه لاتین…………………………………………………………………………………………………. 148

منابع……………………………………………………………………………………………………………. 149

برای دریافت پروژه اینجا کلیک کنید

دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word) دارای 24 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word) :

دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word)

نگرش های مولکولی و فیزیولوژیکی به تحمل خشکسالی

آب عامل اصلی محدود کننده در کشاورزی جهان می باشد. در کل اغلب گیاهان زراعی، حتی به یک تنش ملایم از دست دادن آب نیز به دشت حساس هستند. با وجود این، چند جنس از گیاهان مختص آفریقای جنوبی وجود دارند که قابلیت بسیار بالا برای مقاومت در برابر از دست دادن آب و خشک شدن را دارند. به این جنس ها، گیاهان قیامت “resurrection Plants” گفته می شود.

ما از Xerophta viscose به عنوان نمونه گیاهان قیامت (تک لپه ای) استفاده کردیم تا ژن های مرتبط با تحمل فشار اسمزی را استخراج کنیم. چندین ژن که بصورت متمایز بیان می شوند، در سطوح بیوشیمایی و ملکولی مورد مطالعه قرار گرفتند. این ژنها همان هایی هستند که قابلیت عملکردی خوبی به اشریشیاکلی در شرایط تنش اسمزی می دهند. ما در این مقاله از این آزمایش به عنوان پایه ای برای بحث درباره نگرش های ملکولی و فیزیولوژیکی به تحل خشکسالی، استفاده خواهیم کرد.

(osmoprotectants)، آبسیزیک اسید (ABA) و عوامل رونویسی

مقدمه:

آب یک جزء مهم و اساسی در متابولیسم تمام ارگانیسم های رانده است. آب، انجام شدن بسیاری از واکنش های حیاتی زیست شناختی را بوسیله دارا بودن خصوصیاتی نظیر حلالیت، فراهم کردن محیط انتقال، سرد کردن محیط از راه تبخیر، تسهیل می کند. (Bohert et al., 1995).

در گیاهان و سایر فتواتوتروف ها، آب نقش مهمی در فراهم کردن انرژی مورد نیاز برای پیشبرد فتوسنتز دارد. ملکولهای آب، طی فرآیندی بنام اتولیز شکسته شده و الکترونهایی بر جای می گذارند که این الکترونها برای به چرخه درآوردن انرژی نوری ذخیره شده در فتوسیستم II ضروری می باشند. (Salisbury an Ross, 1992a)

یکی از پیامدهای مهم تنش خشکی، از دست دادن آب پروتوپلاسمی است که منجر به افزایش غلظت یونهایی مانند می شود. در غلظت های بالا چنین یونهایی به طور موثری مانع عملکرد متابولیکی می شوند (Hartung et al., 1998). همچنین افزایش غلظت اجزای تشکیل دهنده پروتوپلاسم و از دست دادن آب سلول باعث ایجاد وضعیت خاصی به نام «حالت شیشه ای: glassy state» می شود. در این حالت، ویسکوزیته مایع موجود در داخل سلول بیشتر می شود که در نتیجه باعث افزایش احتمال برهم کنش های مولکولی و واسرشت شدن پروتئین ها و فیوژن غشا می شوند. (Hartung et la., 1998; Hoekstra et al., 2001).

بنابراین گیاه برای حفظ تورگور سلولی و عملکردهای متابولیکی نیاز به بیان ژنهای خاصی دارد. گروه تحقیقاتی ما می کوشد گیاهان تراژنی زراعی و همچنین وحشی را که قادر به مقاوت در برابر خشکی باشند، ایجاد کند. منبع ژنها گیاهی به نام Xerophyta viscose (Baker) از خانواده Vello=iaceae است که متعلق به گروه کوچکی از نهاندانگان می باشد. این گیاه به علت قابلیت فوق العاده تحمل خشکی به «گیاه قیامت» ملقب شده است (Farrant, 2000, Gaff, 1977).

این گیاه (X. viscose) تا 5 درصد محتوای آب نسبی (RWC) می تواند آب از دست دهد و آبیاری مجدد این گیاه تقریباً به مدت 80 ساعت آنرا سیراب کرده و گیاه فعالیت های یزیولوژیکی خود را از سر می گیرد. (Sherwin and Farront, 1998).

ژنهایی که در این مقاله مورد بررسی قرار خواهند گرفت، شامل موارد زیر هستند: (XVPer 1 (کد کننده یک آنتی اکسیدان)، VATP1XV (کد کننده یک پروتئین زیر واحدی C مانند از آنزیم –H+ آدنوزین تری فسفاتاز)، XVGOLS (کد کننده یک گالاکتینول سنتاز)، ALDRXV4 (کد کننده یک آلدوز ردوکتاز)، XVSAP1 (کد کننده یک پروتئین متصل شونده به غشای سلولی) و DREB1A (کد کننده یک عامل رونویسی). برای تعیین اثرات ناشی از بیان این ژنها در تک لپه ای ها، آنها را به گیاه علفی بنام Digitaria sanguinalis انتقال دادیم و برای انتقال این ژنها خودمان یک سیستم انتقال طراحی کرده ایم (chen et al., 1998). سپس اگر نتایج مثبت باشند، ژنها به محصولات زراعی مانند ذرت (Zea mays) نیز منتقل خواهند شد. برای انجام چنین کاری بر روی دو لپه ای ها، ما نخست آن ژن ها را به Arabidopsis thaliana و Nicotina tobacum منتقل می کنیم.

پدیده تحمل خشکی یک پدیده پیچیده است که شامل بیان سازمان یافته ژنهای زیادی است (Walters et la., 2002) به عبارت دیگر، برای بدست آوردن گیاهان مقاوم در برابر خشکی، چند ژن باید به طور همزمان بیان شوند (Co-expression).

به عنوان مثال، بیان XVPer1، که به نظر می رسد DNA را در برابر گونه های فعال اکسیژن محافظت می کند، همزمان با بیان XVSAP1، که احتمالاً از تراوایی غشا جلوگیری می کند، همراه با بیان XVGOLS و ALDRXV4 که هر دو محافظت کننده اسمزی هستند، مجموعه ای از پروتئین های مرتبط به هم را نتیجه می دهد که با همکاری یکدیگر خصوصیت مقاومت در برابر خشکی را نتیجه می دهند.

برخی تغییرات ساختاری و فیزیولوژیکی ایجاد شده در سطح سلولها و در نتیجه در تمام پیکر گیاه از آنجائیکه پاسخ گیاهان به خشکی پیچیده و مختلف است، بنظر نمی رسد که فقط یک ژن در ایجاد تحمل خشکی نقش داشته باشد. بنابراین نیاز به درک پاسخ فیزیولوژیکی گیاهان تحت شرایط کمبود آب از اهمیت خاصی برخوردار است. (رجوع شود به Alpert and Oliver, 2002; Levitt, 1980, Walters et la. 2002 برخلاف گیاهان عادی، که پتانسیل آب را بالاتر از محیط حفظ می کنند و تلاش می کنند به فعالیت خود در دوره های کمبود آب ادامه دهند، گیاهان مقاوم خشکی یک استراتژی کاملاً متفاوت را به کار می گیرند: بافت های زنده تمام آب آزاد خود را از دست می دهند و سپس به طور آنی آب در دسترس بافت ها قرار می گیرد. این توانایی غیرعادی برای بقا در فقدان شدید آب در بافتهای زنده فقط در 100 نهاندانه مشاهده شده است (Gaff, 1977). اگر چه گیاهان قیامت ارزش اقتصادی چندانی برای کشاورزی ندارند، فهم بیشتر این پدیده می تواند نگرشهایی در مکانیسم های ممکن برای بهبود مقاومت گیاهان زراعی، ایجاد کند. در واقع روشهای زیادی وجود دارد که بوسیله آنها گیاهان مختلف به خشکسالی پاسخ می دهند (خلاصه شده در نمودار 1)

هستند (مثل ذرت)، باشد.

پایداری غشای سلولی

غشای سلولی نقش مهمی در حفظ انسجام سلولی، شرکت در انتقال سیگنالها، و در همئوستازی یونی در شرایط تنش خشکی بر عهده دارد. شوک اسمزی به سلولهای حساس به اسمز منجر به آسیب جبران ناپذیر غشای سلولی می شود. از سوی دیگر سلولهای مقاوم اسمزی اگر دارای مکانیسم های درونی شرکت کننده در پایداری غشا باشند می توانند دقت تنش آب زنده بمانند. شوک اسمزی شامل یک تغییر جزئی القاء شده بوسله دوگانه دوتسی در غشاء است که در هنگام شروع خشک شدن ظاهر می شود و نشان داده شده است که عملکرد سیگنالی دارد. سیگنال القاء شده بوسیله تغییر غشاء منجر به بیان پروتئین های فراوان embrycgenesis متأخر و پروتئین های شوک حرارتی در دانه ها می شوند. در طی دهیدراته شدن، ترکیبات دوگانه دوست سیتوپلاسمی از لحاظ غلظت و partition در غشاء افزایش می یابند و باعث اختلال در هم سلولهای حساس و هم سلولهای مقاوم می شوند. در مرحله میانی، در سلولهای مقاوم، حضور محلولها (قندها) سطح غشار را هیدراته نگه می داد رو از fusion غشا جلوگیری می کند. پایین تر از 0.3 گرم آب در g1 وزن خشک سلولی، ملکولهای قند در سلولهای مقاوم آب را در پوشش هیدراسیون غشا جاسازی می کنند و در نتیجه فضای بین ملکولهای فسفولیپید را حفظ می کنند.

Grawe et la., 2002 پینشهاد کرده است که یک CDNA، X VSAP1 از مجموعه CDNA استخراج شده از برگهای دهیدراته شده X. viscosa، نقشی در پایداری غشاء ایفا می کند. XVSAP1 خصوصیات مشترک زیادی با خانواده انتقال دهنده های k+ دارد. XVSAP1 پیش بینی شده شامل یک پروتئین سیار آبگریز با دو مکان برای اتصال چربی سیپوپروتئین به غشا می باشد. حضور این مکان ها مفهومی را تقویت می کند که بیان می کند: XVSAP1 به صورت کاملاً نزدیک با غشای سلولی ارتباط دارد و می تواند یکی از ترکیبات شکرت کننده در تعمیر آسیب غشایی ناشی از کمبود آب باشد.

بیان ژنهای پاسخی به تنش توسط مکان یابی عوامل رونویسی

ژنهای القاء شده در شرایط تنش کمبود آب می توانند به دو گروه تقسیم شوند. الوی پروتئین هایی را که مستقیماً در حفاظت نقش دارند و دومی پروتئین هایی را که در تنظیم transduction سیگنالی و بیان ژن نقش دارند، کد می کند. بعد از احساس کمبود آب توسط سلول، مکانیسم سیگنالی باید فعال شود تا ژنهای خاصی را برانگیخته کند. شرایط مختلف، ژنهای القاء شده توسط تنش مختلفی را برانگیخته می کند و بنابراین باید چندین مکانیسم سیگنالی مختلف وجود داشته باشد.یکی از سیگنال های اصلی عمل کننده در XVSAP1 تنش آب، هورمون گیاهی آبسیزیک اسید، ABA، است. مطالعات روی ABA، نشان داده است که این هورمون در چندین فرآیند فیزیولوژیکی و تکاملی مختلف (که این فرآیندها بر روی فعالیت های زراعی مانند بلوغ جنین و جوانه زنی تأثیر می گذارند)، علاوه بر پاسخ بافت های زنده و تنش اسمزی، وساطت می کند. ABA در نتیجه تنش آب افزایش پیدا می کند و نقش های مهمی در مقاومت گیاهان در برابر خشکی، شوری بالا و سرما دارد.

الگوهای بیان ژن های القا شده بوسیله خشکی پیچیده اند. بعضی از ژنها خیلی سریع به تنش پاسخ می دهند در حالیکه، بعضی دیگر به آهستگی بعد از انباشته شدن ABA برانگیخته می شوند. اکثر ژنهایی که به خشکی پاسخ می دهند همچنین بوسیله کاربرد ABA exogenous برانگیخته می شوند. برخی از ژنها وجود دارند که بوسیله تنش خشکی برانگیخته می شوند اما در هنگام مواجه شدن با exogenous ABA پاسخی نمی دهند. این یافته ها وجود هم زمان جریانها آبشاری سیگنالهای وابسته به ABA و مستقل از ABA را بین سیگنال اولیه تنش خشکی یا سرما و یان ژنهای خاص را نشان می دهند. این ژنهای القاء شونده بوسیله دهیدراته شدن شامل عناصر بالقوه پاسخ دهنده به ABA (ABREها) با تولای (Py ACGT GGC) در ناحیه پروموتور خود هستند. یک ABRE به عنوان یک عنصر DNA Cis-acting شرکت کننده در بیان ژنهای تنظیم شده بوسیله ABA عمل می کند و اولین بار در Em گندم و ژنهای rab برنج شناسائی شده بود. یک پروتئین متصل شونده به DNA و ABRE بنام EmBP-1 نشان داده شده است که یک پروتئین Bzip را کد می کند. G-box موتیف ABRE را مجتمع می کند و در تنظیم ژنها گیاه در شرایط مختلف محیطی عمل می کند. یک عنصر جفت شونده مورد نیاز است تا بتوان عملکرد ABRE را که یک مجموعه پاسخی از به ABA را تشکیل می دهد، در تنظیم ژن HVA22 مشخص کرد. سایر عناصر Cis-acting که در بیان ژنهای پاسخی به ABA، نه فقط در شرایط تنش خشکی بلکه همچنین درخشک شدن دانه عمل می کنند. جعبه Sph و جایگاه های اتصال MYC, MYB در ژن Arabilopsis rd22 می باشند. اخیراً یک عامل رونویسی (CPR18) ا زگیاه قیامت Craterostigma plantagineum که به ناحیه پروموتوری الزامی برای بیان با واسطه ABA ژن CdeT27-45 متصل می شود، استخراج شده است. این ژن دارای یک ناحیه Cis-regulatory 29 جفت بازی (AAGCCCAAATTTCACAGCCCGATA) است که در پروموتور ژن Cde27-45 از C.plantagineum موجود است.

برای دریافت پروژه اینجا کلیک کنید

دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word) دارای 54 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word) :

پایان نامه عکاسی با موضوع “دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word)”

فصل اول : کلیات تحقیق
فصل دوم : پیشینه تاریخی
فصل سوم : تحقیق

مقدمه :
قرن بیستم عصر رسانه ها و ارتباطات است . میلیونها نفر از مردم جهان ، هر روز از طریق عکس و تصویر از جریان رویدادها و تحولات سیاسی ، علمی و هنری آگاه می شوند .
رسانه ها با بهره گیری از عکس و تصویر ، در ابعاد مختلف گاه به شکل روزنامه ، مجله ، کتاب و گاه به صورت اسلاید ، فیلم ، تلویزیون ، ویدئو ، همواره در رشد آگاهی عمومی نقش انکار ناپذیری داشته اند. اگر انسان قدم بر کره ماه می گذارد یا در اعماق اقیانوس ها کند و کاو می کند ، عکس و تصویر با چشم ناظر ، همگام و همراه است و در ثبت لحظات حساس و با شکوه به ما مدد می رساند.
در این رساله می خواهیم به مختصری از هنر عکاسی و سبکها و مکاتب آن به چشمه کوچکی از آن اشاره کنیم و بتوانم به علم خود بیافزاییم…

بیان مسئله:
عکاسی یکی از بزرگترین اختراعات بشری است که فناوری در موارد متعددی تکامل و پیشرفت خود را مرهون آن است . از سوی دیگر جلوه های هنری آن افق دید واقع گرایانه و وسیع تری را از جهان رمز آلود در فراسوی دیدگانمان تصویر می کشد. در این پژوهش به این مهم دست خواهیم یافت که عکاسی چگونه در جهان رشد و نمو یافته است و به راستی کدام جنبه و جلوه آن در زندگی پررنگتر و کاربردی تر است؟ و چه بهره هایی بشر از آن برده است.
ضرورت مسئله :
در این پژوهش کسب معلوماتی جزئی از کلیت است و همچنین پاسخ به این سئوال که زاویه دید هنرمندانه یک عکاس حرفه ای چگونه بوده است که حتی بعد از گذشت سالیان متمادی اثر هنری وی هنوز خیره کننده و تحسین برانگیز است .
هدف مسئله :
تلفیق روش های سنتی و امروزی با یکدیگر و کاربرد آن و دیگر هنرها ، همچنین افزایش خلاقیت در راستای حرفه خود و افزایش دانش علاقه مندان این هنر

پرسش های مسئله :

فتو مونتاژ چیست ؟

جنبه های روانشناختی پرتره پیست ؟

عکاسی مد چیست ؟

عکاسی ذهنی چیست ؟

عکاسی در باهاوس چگونه بودهاست ؟

چه تاثیری سورر ئالیسم بر عکاسی گذاشته است ؟

عکاسی تبلیغاتی چیست ؟

هنر عکاسی در حیات وحش چگونه است ؟

عکاسی هنری چیست ؟

چه تاثیر فتو شاپ برعکاسی دارد ؟

عکاسی خلاق چیست ؟

پاپ آرت چیست و چه تاثیری بر عکاسی داشت ؟

عکس رو پوستر چه تاثیری دارد ؟

زاویه دید در عکس چه تاثیری بر کاربرد آن در صفحه آرایی دارد ؟

عکاسی ژورنالیستی چیست ؟

برای دریافت پروژه اینجا کلیک کنید

دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word) دارای 19 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word) :

بررسی ریاضی(سیستم اعداد مانده‌ای)

سیستم اعداد مانده‌ای (باقیمانده)

سیستم اعداد مانده‌ای یك سیستم اعداد صحیح است، كه مهمترین ویژگی‌اش بطور ذاتی انتقال رقم نقلی مجازی در جمع و ضرب و تفریق‌هاست، همچنین نتجه جمع و تفریق و ضرب اعداد ما در مرحله اول بدون در نظر گرفتن طول اعداد مشخص می‌شود، متأسفانه در سیستم اعداد مانده‌ای عملیات ریاضی دیگری مانند تقسیم و مقایسه و شناسایی علامت خیلی پیچیده و كند هستند از مشكلات دیگر سیستم اعداد مانده‌ای این است كه چون با سیستم اعداد صحیح كار می‌كند در نتیجه نمایش اعداد اعشاری در سیستم اعداد مانده‌ای خیلی ناجور است با توجه به خواص سیستم اعداد مانده‌ای نتیجه می‌گیریم كه در اهداف عمومی كامپیوترها (ماشین حساب‌ها) به صورت كاملاً جدی نمی‌تواند مطرح بشود. بهرحال ، برای بعضی از كاربرها كه اهداف خاصی دارند مثل بسیاری از انواع فیلترهای دیجیتال، تعداد جمع و ضرب‌هایی كه اساساً بزرگتر تعداد و درخواست بزرگی دامنه و شناسایی سرریز، تقسیم و شبیه این‌ها، سیستم اعداد باقیمانده خیلی جذاب و جالب می‌تواند باشد.

1-1) مقدمه

سیستم اعدادمانده‌ای اساساً بوسیله یك مبنای چندتائی (N – تائی) و نه یك مبنای واحد مثل از اعداد صحیح مشخص می‌شود. هر كدام از ها باقیمانده پس از تقسیم یك عدد بر آن‌ها است.عدد صیح X در سیستم اعداد مانده‌ای بوسیله یك N -تائی مثل نمایش داده می‌شود كه هر یك عدد غیرمنفی صحیح است كه در رابطه زیر صادق است:

X

0

1

0

1

0

1

0

1

0

1

0

1

0

2

0

1

2

0

1

2

0

1

2

0

1

2

-4

-3

-2

-1

0

1

2

3

4

5

6

7

8

جدول 1-1 نمایش اعداد در سیستم اعداد مانده‌ای به پیمانه‌

بزرگترین عدد صحیحی است بطوریكه معروف است به باقیمانده X به پیمانه Mi ، و در روش نوشتن اعداد هر دو و با یك مفهوم استفاده می‌شوند.

مثال 1-1 سیستم اعدادمانده‌ای 2- باقیمانده‌ای با پیمانه‌های را ملاحظه كنید در این سیستم نمایش عدد صحیح x=5 به صورت نمایش داده می‌شود كه و از رابطه‌های زیر بدست می‌آیند.

چونكه

چونكه

بنابراین در این سیستم اعداد مانده‌ای با پیمانه‌های و عدد صحیح 5 به صورت (2,1) نشان داده می‌شود.

عدد X لزوماً نباید یك عدد صحیح مثبت باشد بلكه می‌تواند عدد صیح منفی هم باشد برای مثال اگر X=-2 باشد آنگاه

چونكه

چونكه

نكته‌ای كه در اینجا وجود دارد این است كه ها مثبت تعریف می شوند .

بنابراین عدد صیح -2 در سیستم اعداد مانده‌ای با پیمانه‌های و بصورت نمایش داده می‌شود.

جدول 1-1 اعداد صحیح در محدوده [-4,8] را در سیستم اعداد مانده‌ای به پیمانه نمایش داده است.

همانطور كه از جدول 1-1 مشخص است نمایش مانده‌ای یك عدد صحیح منحصر بفرد است در حالی كه بر عكس این مطلب درست نیست و نمایش صحیح دو یا چند عددمانده‌ای ممكن است یكسان باشد برای مثال نمایش صحیح (1،1) هم عد یك می‌شود و هم عدد هفت، پس در نتیجه ما باید دامنه اعدادی را كه نمایش داده می شوند محدود كنیم، همنطور كه از جدول 1-1 مشخص می‌شود نمایش مانده‌ای دوره‌ای است و تكرار می‌شود و در اینجا محدوده تكرارش شش است، ما در سیستم اعداد مانده‌ای به پیمانه فقط شش نمایش مختلف دادیم چونكه دو مقدار مختلف سه مدقار مختلف می‌توانند به خود بگیرند، بنابراین ما باید ناحیه نمایش را به شش عدد محدود بكنیم، دو ناحیه‌ممكن در جدول مشخص شده‌اند، اولی و دومی است.

در حالت كلی در سیستم اعدادمانده‌ای می‌توان گفت كه تعداد نمایش‌های غیرتكراری برابر است با كوچكترین مضرب مشترك پیمانه‌‌ها، كه به صورت زیر نمایش داده می‌شود.

مثال 2-1

برای جمع دو عدد y=2 , x=1 در سیستم اعداد مانده‌ای به پیمانه‌ ، اولین كاری كه انجام می‌دهیم این است كه هر كدام از این اعداد را در سیستم اعداد مانده‌ای با این پیمانه نمایش می‌دهیم كه نمایش این اعداد به ترتیب به صورت (1 ، 1) و (0 ، 2) می‌باشد.

تتیجه نهایی برابر (1 ، 0) در سیستم اعداد مانده‌ای با پیمانه (3,2) است كه نمایشگر عدد 3 می‌باشد. ضرب دو عدد X و ‎ در هم نیز به صورت زیر است.

نتیجه ضرب X و Y در همدیگر در این سیستم (2,0) می‌شود كه نمایشگر عدد 2 می‌باشد.

برای انجام عمل تفریق اول ما معكوس جمع را تعریف می‌كنیم، معكوس جمع عدد c به پیمانه را به این صورت تعریف می‌كنیم.

چونكه

برای مثال

به بیانی دیگر، معكوس جمع یك عدد را می‌تواند مكمل باقیمانده نسبت به پیمانه‌اش باشد و سپس در ادامه معادله تفریق را به صورت زیر تعریف می‌كنیم.

در اینجا از تعریف معكوس جمع استفاده می‌كنیم و به شكلی دیگر كه در پایین آمده عمل تفریق می‌نویسم.

برای مثال اگر دو عدد Y=3 , X=5 در سیستم اعداد مانده‌ای با پیمانه داشته باشیم آنوقت عمل تفریق x-y به صورت زیر انجام می‌شود.

كه (2,0) نمایشگر مقدار2 می‌باشد.

مثال 3-1

سیستم اعداد مانده‌ای با چهار پیمانه (7,5,3,2) = را در نظر می‌‌گیریم در این سیستم‌ها همه پیمانه‌ها دوبه دو نسبت به هم اول هستند پس

حال عمل ضرب و جمع دو عدد X=3 و Y=4 را در این سیستم انجام می‌دهیم كه اعداد X=3 و Y=4 در این سیستم به ترتیب با (4,4,1,0) , (3,3,0,1) نمایش داده می شوند .

عمل جمع و ضرب این دو عدد در این سیستم بدینگونه انجام می‎شود.

2)

3

5

(7

2)

3

5

(7

1)

0

3

(3

3

1)

0

3

(3

3

0)

1

4

(4

× 4

0)

1

4

(4

× 4

0)

0

12

(12

12

1)

1

7

(7

7

0)

0

2

(5

1)

1

2

(0

اعداد (5,2,0,0) و (0,2,1,1) در سیستم اعداد مانده‌ای به پیمانه (7,5,3,2) = به ترتیب نمایشگر اعداد 12 و 7 هستند كه جواب درست عملیات جمع و ضرب ما می‌باشند. اما وقتی كه ما جمع دو عدد 7 و 206 را كه در این سیستم اعداد مانده‌ای به ترتیب با (0,2,1,1) و (3,1,2,0) انجام می‌دهیم عدد (3 , 3 , 0 , 1) در این سیستم اعداد مانده‌ای بدست می‌آید كه نمایشگر عدد 3 می‌باشد.

دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word)
فهرست

عنوان صفحه

1-1) مقدمه………………………………………………………………………………………… 2

2-1) عملیات ریاضی……………………………………………………………………………. 7

1-2-1) معكوس ضرب……………………………………………………………………….. 10

3-1) سیستم اعدادمبنای در هم وابسطه………………………………………………… 12

4-1) تبدیل اعداد به سیستم اعداد مانده‌ای و برعكس………………………………. 22

1-4-1-) تبدیل اعداد از سیستم باینری به سیستم مانده‌ای …………………….. 24

5-1) انتخاب پیمانه………………………………………………………………………………. 26

برای دریافت پروژه اینجا کلیک کنید