دانلود بررسی شاخه نرمتنان در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی شاخه نرمتنان در فایل ورد (word) دارای 14 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی شاخه نرمتنان در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی شاخه نرمتنان در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی شاخه نرمتنان در فایل ورد (word) :

دانلود بررسی شاخه نرمتنان در فایل ورد (word)

شاخه نرمتنان (Phylum Mollusca)

اعضای شاخه نرمتنان بدن نرم و بدون تقسیمی دارند. معمولاً سر آنها در قسمت جلو است و یك پای شكمی و توده‌ احشایی پشتی نیز در بدن آنها وجود دارد. بدنشان كم و بیش از یك روپوش (Mantle) نازك احاطه شده است اغلب در یك صدف آهكی خارجی محفوظ اند. این شاخه از پنج رده تشكیل میگردد كه از لحاظ ظاهر، طرز زندگی و رشد با یكدیگر اختلاف دارند.

1- رده دو عصبیها مانند كیتونها

2- رده ناوپایان مانند دنتالیوم

3- رده شكمپایان مانند حلزونهای صدفدار و بی‌صدف.

4- رده تبرپایان مانند صدفهای خوراكی دو كفه‌ای

5- رده سرپایان مانند نوتیلیها

6- اسكوئیدها ، هشتپایان و غیره

فسیل شناسی نرم تنان:

یكی‌ از مهمترین بخش های بی‌مهرگان خصوصاً از نظر مطالعه فسیل شناسی نرم تنان است. نرم تنان در دریا، آبهای شیرین، دریاچه‌ها و بالاخره خشكی زندگی می‌كند.

نام نرمتنان اصولاً برای انواع به كار برده شده كه قسمت سخت ندارند و لذا به دو دسته تقسیم شدند: دسته‌ای دارای قسمت سخت و دسته‌دیگر بدون قسمت سخت می باشند.

اساسی تقسیم بندی جدید به وسیله‌ دانشمندی فرانسوی پایه گذار شد و او بر اساس شباهت قسمتهای نرم و قسمتهای سخت، نرم تنان را به سه رده تقسیم بندی كرده كه عبارتند از: گاستروپودار، سفالوپودا و دو كفه‌ای‌ها .

صور مشخصه نرم تنان عبارت است از:

1- عدم بند بند بودن بدن

2- تقارن ارگانیسم بدن نسبت به یك صفحه

3- مركزیت عضو حساس در سر (به استثناء پلسی پودا)

4- پوشیده شدن بدن به وسیله پوست

5- خواص اختصاصی دستگاه گوارش و سیستم عصبی

6- صور مشخص در حالات لاروی

پوست دارای سلول‌هایی است كه غشاء را ترشح می‌كند. غشاء در كلیه نرم تنان از كربنات كلسیم ساخته شده و تمام یا قسمتی از آن به صورت كلیست یا آراگونیت است. معمولاً غشاء خارجی گاهی كاملاً داخلی است.

رده گاستروپودا: بدن معمولاً در یك غشاء مارپیچ غیرمتقارن قرار دارد. سر مشخص و دارای یك یا دو زوج Tentacle و یك زوج چشم است. پا عریض و مسطح است ولی در انواع شناگر به شكل بال مانندی در می‌آید.

رده شكم پایان

رده شكم پایان بزرگ‌ترین و متنوع‌ترین گروه از نرم تنان است و دربرگیرنده بعضی از ابتدایی‌ترین نرم تنان (بعضی از شكم پایان دریازی) و بعضی از تكامل یافته‌ترین آن ها (بعضی شكم پیان خشكی زی) است. صدف این جانوران یك تكه و معمولاً مخروطی شكل است كه توده‌ احشایی را احاطه كره است. سر و پای عضلانی معمولاً تقارن دو طرفی دارد ولی این تقارن به علت پنج خوردن توده احشایی، در توده احشایی به چشم نمی خورد.

شكم پایان از طریق جلد (جبه) و یا حفره جبه كه نقش شش را بازی می كند، تنفس می‌كند. جداش و یا تك جنس و هر مافرودیت هستند و در عده‌ای چرخه زندگی مستقیم است.

در شكمپیان (به یوننی Gaster = شكم + Podos= پا) سر كه در قسمت جلو بدن است، پای شكمی، كه طویل است تقارن دو جانبی دارد. توده احشایی معمولاً درون یك صدف پشتی جای میگرد و هر دو بطور مارپیچی پیچیده و غیر متقارن میباشد. سر توده كم و بیش استوانه‌ای شكلی است كه بدون آنكه از بقیه‌ بدن مشخص باشد بطرف جلو ادامه دارد. بر روی سر زواید حسی موجود است كه شاخك نامیده میشود و بر حسب نوع حیوان متفاوت میباشد. دهان در انتهای قدامی بدن واقع است و در داخل دهان زبانه‌كوچكی وجود دارد بنام سوهانك. در این عضو دندانهایی وجود دارد كه تعدادش در انواع مختلف متفاوت است و در بعضی نمونه‌ها بالغ بر چندین هزار است.

چین خوردگی پوست بدن یا روپوش حفره وسیعی را تشكیل می دهد كه آنرا حفره روپوشی مینامند.

دستگاه دم زدن، مجرای مواد دفعی و مجرای دستگاه تناسلی، در حفره روپوشی قرار دارد.

در شكمپایان اجدادی شاید در همه قسمتها تقارن دو جانی وجود داشته است.

ولی در گونه‌های زنده قرینه دو طرفی كامل از بین رفته است زیرا بدن جانور در حول محوری كه از رأس صدف عبور مینماید 180 درجه یا كمتر دوران حاصل نموده است و در اثر این دوران حفره روپوشی در نزدیك سر جانور قرار گرفته است.

شكمپایان معمولاً دارای یك جفت چشم هستند كه بر روی سر و احیاناً در انتهای قدامی بدن روی شاخكها قرار گرفته ‌است.

حلزون باغی:

نام علمی حلزون معمولی كه در باغ‌ها به چشم می‌خورد Helixaspersa است.

موجود فعال از نظر ظاهری یك قسمت پایی- سری دارد كه سر در جلویی ترین بخش آن واقع است و با دو جفت شاخك (جفت اول حسی و جفت دوم چشمی) از بقیه قسمت‌های آن متمایز است. دهان كه یك منفذ شكاف مانندی است و دست زیر حد جلویی پایی – سری واقع است، چندان مشخص نیست. پای عضلانی كه دارای تقارن دو طرفی است مرز مشخصی با سر ندارد. توده احشایی مركب از امعاء و احشاء پیچ خورده، توسط یك صدف یك تكه‌ مارپیچ احاطه شده است.

جبه پوشاننده توده‌ احشایی در حاشیه پائینی كمی ضخیم‌تر است (جز در یك نقطه به نام منفذ و یا به نوموستوم كه در سمت راست بدون قرار دارد) و یقه‌ جبه نامیده می‌شود. در محل نوموستوم جبه با دیواره ‌بدن اتصال ندارد و حفره جبه كه یك دیواره عروقی دارد و هوادار است. از فاصله گرفتن جبه از دیواره‌ بدن ایجاد شده است. این حفره نقش ریه یا شش را برای جانور بازی می كند؛ عروق دیواره‌ حفره به كمك هوا، اكسیژنه می‌شوند. اكسیژن به قلب می رسد و توسط سرخرگ ها به دیگر نقاط بدن انتقال می‌یابد. خون تیره نیز به قلب باز می گردد و از قلب به حفره جهت تبادل جریان می‌یابد.

منفذ تناسلی كوچك است و در نزدیكی پایه شاخك چشمی در سمت راست قرار دارد. تنها منفذ اداری و مخرج به می‌شوند و موقعیت آن‌ها به این ترتیب است كه مخرج كمی عقب منفذ ریه و منفذ اداری كمی بالای مخرج قرار دارد.

در این جانور جز منفذ ریه، منفافذ اداری و مخرج از بیرون نمایان نیستند.

برای دریافت پروژه اینجا کلیک کنید

دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word) دارای 149 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word) :

بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران

خلاصه:

در كشورهای در حال توسعه, آلودگی مواد غذائی و بیماربهای ناشی از آن همواره به عنوان یكی از مهمترین مشكلات در سیستم بهداشت مواد غذائی بشمار می آید.

اگرچه در كشور ما ارتقاء سطح بهداشت عمومی در نتیجه بهبود نظام عرضه خدمات بهداشتی باعث كاهش میزان مرگ و میر در سالهای اخیر شده است, با این وجود پی آمدهای نامطلوب تغذیه ای و بهداشتی ناشی از آلودگی مواد غذائی با عواقب زیانبار اقتصادی همراه می باشد.

علت مهم ایجاد مسمومیت و بیماریهای روده ای, مواد غذائی می باشد, یكی از این مواد غذائی كه از نظر آلودگی اهمیت به سزائی دارد, شیر و فراورده های آن نظیر بستنی است. بستنی بخصوص در فصول گرم دارای مصرف كننده بسیاری می باشد و در مورد این ماده غذائی باید از نظر بهداشتی نظارت كامل صورت گیرد. به منظور بررسی آلودگی باكتریائی در بستنی های سنتی ومیوه ای( غیر پاستوریزه) و بستنی های پاستوریزه, تعداد 100 نمونه بستنی غیرپاستوریزه و 30 نمونه بستنی پاستوریزه از قسمتهای مختلف شهر تهران بصورت
Random Systematic Samplingجمع آوری شد كه پس از انجام آزمایشات در آزمایشگاه كنترل كیفی مواد غذائی, آرایشی و بهداشتی واقع در مركز فایلات علوم پزشكی ایران, 87 درصد از نمونه های غیر پاستوریزه فیرقابل مصرف و باكتریهای موخود در آنها به ترتیب فراوانی عبارت بودند از:

استافیلوكوك اورئوس(74%), گونه های كلبسیلا(40%), گونه های انتروباكتر(37%), اشریشیا كلی(24%),سودوموناس آئروجینوزا(19%),گونه های پروتئوس(13%), گونه های اسینتوباكتر(11%), هافنیا(6%), گونه های آلكالی ژنز(4%), گونه های سراتیا(3%),گونه های سیتروباكتر و ادواردسیلا(2%) و گونه های پروویدنسیا(1%).

و در بستنی های پاستوریزه, 30 درصد از نمونه ها غیر قابل مصرف بودند و باكتریهای موجود در آنها به ترتیب فراوانی عبارت بودند از:

اشریشیا كلی(4/13%), استافیلوكوك اورئوس(7/6%), كلبسیلا نومونیه(7/6%), سودوموناس آئروجینوزا, پروتئوس ولگاریس, انتروباكتر كلواكه و اسینتوباكتر بامانی(3%).

برای بررسی لیستریا و یرسینیا از محیط های اختصاصی Palcam , CiN و غنی سازی در سرما(Cold enrichment ( استفاده شد ولی علی رغم تلاشهای بسیار موفق به جداسازی نشدیم.

مقدمه:

صنایع غذایی همگام با صنایع و تكنولوژی جدید هر روز به صورت چشمیگری گسترش می یابد. ولی با وجود این پیشرفت سریع در صنایع غذایی و كنترل بهداشتی آن شاهد موارد متعددی مسمومیت ناشی از مواد غذایی هستیم. مسمومیت های غذایی و عوارض آن یكی از مشكلات اساسی تمام جوامع می باشد. این موضوع حتی در كشورهای پیشرفته دنیا نیز به میزان زیادی دیده می شود.

از این رو افزایش بیماریهای ناشی از مواد غذایی بسیار نگران كننده تلقی می شود و علیرغم تلاش و پیگیری های دست اندركاران هنوز میزان اندكی از بیماریهای حاصله از آلودگی غذاشناسایی شده اند. عوامل مهم درآلودگی مواد غذایی نوع غذا و اجزای متشكله آن می باشد. بدین صورت كه هر چه ارزش غذایی مواد خوراكی بیشتر باشد و یا نگهداری آن شرایط ویژه ای را طلب كند و نیز در ‏فرآیند تولید آن عواملی همانند میكروارگانیسم افزوده شوند عوامل متعدد غیرمدرنیزه و احتمالا آلوده دخیل باشند آلودگی ماده غذایی و خطر ابتلا به مسمومیت ناشی از آن افزایش می یابد.

یكی از پرمصف ترین مواد غذایی شیر و فرآورده های وابسته به آن است. زیرا شیر و فرآورده های لبنی در تمامی كشورهای دنیا بخشی از غذای روزانه مردم را تشكیل می دهد و به سبب مواد غنی غذایی و سهولت آلودگی شیر، از لحاظ مسمومیت غذایی نیز ماده مهمی محسوب می شود. در این میان آلودگی بستنی كه از فرآورده های شیر محسوب میشود از سه جنبه در خور توجه است، نخست آنكه مصرف بستنی كه در حقیقت یك نوع شیرینی خنك می باشد، عموما در فصل تابستان صورت می گیرد كه خطر ابتلاء آلودگی مواد غذایی در این فصل بیشتر است.

ثانیا: مصرف بستنی در بین همه مردم خصوصا كودكان شایع تر است و چون از غذاهای بسیار مطبوع و لذیذ به شمار می آید، مصرف آن به صور گوناگون نیز هر روز فزونی می یابد.

ثالثا: در تهیه بستنی از مواد مختلفی استفاده می شود كه هر كدام از آنها می توانند منشا آلودگی شده و سبب بیماری گردند. همچنین میكروارگانیسم ها می توانند بصورت ثانویه از طریق تهیه كنندگان و فروشندگان بستنی وارد آن گردند. بنابراین توجه به مسمومیت ناشی از آلودگی بستنی بخصوص در كشور ما كه در تولید آن روش های سنتی بیشتر معمول است، باید مورد توجه قرار گرفته و فایلات كافی در مورد انواع بیماریهای ناشی از آلودگی بستنی و نیز راههای آلوده شدن آن صورت گیرد.

با توجه به اهمیت این موضوع و پیشنهاد جناب آقای دكتر امیر مظفری و سركار خانم فروهش تهرانی بر آن شدم تا كار خود را روی این موضوع اّغاز كنم.

شایان ذكر است كه به علت كمبود امكانات و نیز محدود بودن نمونه های برداشت شده و تحت پوشش قرار نگرفتن تمامی مناطق تهران جهت نمونه گیری بررسی و فایل حاضر خالی از اشكال نیست.

دانلود بررسی آلودگی باكتریایی بستنی های مختلف در سطح شهر تهران در فایل ورد (word)
فهرست مطالب

عنوان صفحه

خلاصه فارسی……………………………………………………………………………………………….. 1

مقدمه:………………………………………………………………………………………………………….. 3

فصل اول: زمینه فایل و مروری بر اپیدمیهای رخ داده از شیر……………………………… 5

فصل دوم: كلیاتی در خصوص بستنی…………………………………………………………………. 18

2-1: تاریخچه بستنی……………………………………………………………………………………….. 19

2-2: تعریف بستنی…………………………………………………………………………………………. 20

2-3: ارزش غذایی بستنی………………………………………………………………………………….. 22

2-4: مواد تشكیل دهنده بستنی…………………………………………………………………………… 24

2-4-1: چربی…………………………………………………………………………………………… 24

2-4-2: مواد جامد غیر از چربی……………………………………………………………………. 25

2-4-3: قند……………………………………………………………………………………………… 27

2-4-4: مواد امولسیون كننده…………………………………………………………………………. 29

2-4-5: مواد پایداركننده………………………………………………………………………………. 29

2-4-6: مواد طعم دهنده………………………………………………………………………………. 30

2-4-7: مواد رنگ دهنده……………………………………………………………………………… 30

2-5: فرآیند تولید بستنی…………………………………………………………………………………… 30

2-5-1: مرحله دریافت……………………………………………………………………………….. 30

2-5-2: تولید مخلوط بستنی…………………………………………………………………………. 31

2-5-3: توزین كردن………………………………………………………………………………….. 32

2-5-4: مخلوط كردن…………………………………………………………………………………. 33

2-5-5: یكنواخت كردن گویچه های چربی……………………………………………………… 34

2-5-6: پاستوریزاسیون……………………………………………………………………………….. 34

2-5-7: رسیدن مخلوط……………………………………………………………………………….. 34

2-5-8: افزودن مواد طعم دهنده و رنگ دهنده………………………………………………….. 35

2-5-9: انجماد به روش مداوم……………………………………………………………………… 35

2-5-10: قالب گیری و بسته بندی…………………………………………………………………. 36

2-5-10-1: بسته بندیهای بزرگ بستنی……………………………………………………… 36

2-5-10-2: بسته بندیهای مورد مصرف خانگی……………………………………………. 37

2-5-10-3: تولید بستنی چوبی……………………………………………………………….. 37

2-5-11: سخت كردن بستنی…………………………………………………………………………. 38

2-6: باكتریولوژی بستنی…………………………………………………………………………………… 39

2-7: اپیدمیولوژی آلودگیهای میكروبی………………………………………………………………….. 40

2-7-1: آلودگیهای اولیه بستنی……………………………………………………………………… 41

2-7-2: آلودگیهای ثانویه بستنی…………………………………………………………………….. 45

2-8: پیشگیری و كنترل…………………………………………………………………………………….. 48

فصل سوم: خلاصه ای از خصوصیات عمومی و كلینیكی باكتریهای جدا شده در بستنی. 51

3-1: میكروبیولوژی پایه……………………………………………………………………………………. 52

3-2: میكروبیولوژی لبنیات………………………………………………………………………………… 52

3-3: رشد میكروبی ………………………………………………………………………………………… 54

3-4: میكروارگانیسم ها در شیر…………………………………………………………………………… 57

3-5: مشخصات میكروارگانیسم ها در شیر…………………………………………………………….. 58

3-6: میكروارگانیسم های ایجاد كننده فساد در شیر………………………………………………….. 59

3-7: میكروارگانیسم های بیماریزا در شیر……………………………………………………………… 60

3-8: باسیلهای گرم منفی بی هوازی اختیاری………………………………………………………….. 60

3-8-1: تعریف انتروباكتریاسه………………………………………………………………………. 61

3-8-2: اشریشیاكلی…………………………………………………………………………………… 63

3-8-3: گروه كلبسیلا، انتروباكتر، سراتیا………………………………………………………….. 67

3-8-4: گروه پروتئوس، مورگانلا، پروویدنسیا………………………………………………….. 69

3-8-5: سیتروباكتر…………………………………………………………………………………….. 70

3-8-6: جنس شیگلا………………………………………………………………………………….. 70

3-8-7: جنس سالمونلا……………………………………………………………………………….. 71

3-8-7-1: تشخیص سالمونلا از جنس های دیگر………………………………………… 72

3-8-7-2: آزمایشات تشخیصی……………………………………………………………… 74

3-8-7-3: پاتوژنزو یافته های بالینی………………………………………………………… 75

3-8-7-4: مواد غذایی كه بطور رایج در انتقال سالمونلا نقش دارند…………………. 77

3-9: باكتریهای گرم منفی غیر تخمیری و غیرشایع…………………………………………………… 78

3-9-1: گروه سودموناها……………………………………………………………………………… 78

3-9-1-1: سودمونا آئروجینوزا……………………………………………………………………… 78

3-9-2: یرسینیا…………………………………………………………………………………………. 79

3-9-2-1: یرسینیا انتروكولیتیكا ویرسینیاپسودوتوبركلوزیس…………………………….. 80

3-9-2-2: پاتوژنز و یافته های بالینی………………………………………………………… 81

3-9-2-3: آزمایشات تشخیصی……………………………………………………………… 82

3-9-2-4: پیشگیری و كنترل…………………………………………………………………. 825

3-10: استافیلوكوك…………………………………………………………………………………………. 82

3-10-1: استافیلوكوك اورئوس……………………………………………………………………. 82

3-10-2: مورفولوژی…………………………………………………………………………………. 83

3-10-3: ساختمان سلولی…………………………………………………………………………… 83

3-10-4: مقاومت…………………………………………………………………………………….. 84

3-10-5: خواص بیوشیمیایی……………………………………………………………………….. 85

3-10-6: مسمومین غذایی استافیلوكوكی………………………………………………………… 86

3-10-7: علائم مسمومیت غذایی استافیلوكوكی……………………………………………….. 89

3-10-8: پیشگیری وكنترل در مسمومیت غذایی…………………………………………….. 90

3-11: باسیل های گرم منفی بدون اسپور……………………………………………………………….. 91

3-11-1: لیستریامونوسیتوجنز……………………………………………………………………… 91

3-11-1-1: تاریخچه…………………………………………………………………………………… 91

3-11-1-2: میكروبیولوژی………………………………………………………………………. 91

3-11-1-3: لیستریوزیس………………………………………………………………………… 93

3-11-1-4: وقوع و رشد لیستریا در شیر و فرآورده های آن……………………………. 95

3-11-1-5: حداقل دوز عفونت زایی…………………………………………………………. 99

3-11-1-6: روش های جستجوی لیستریامونوسیتوجنز درمواد غذایی…………………. 100

3-11-1-7: پاتوژنز و ایمنی…………………………………………………………………….. 104

فصل چهارم: روشها و مواد مورد نیاز………………………………………………………………… 106

4-1: مدت مطالعه………………………………………………………………………………………….. 107

4-2: تعداد نمونه…………………………………………………………………………………………….. 107

4-3: نحوه نمونه برداری ………………………………………………………………………………….. 107

4-4: بررسی های انجام شده………………………………………………………………………………. 108

4-5: مواد و وسایل مورد استفاده ……………………………………………………………………….. 108

4-6: روش آماده سازی…………………………………………………………………………………….. 109

4-7: روش آزمایش نمونه های مواد غذایی……………………………………………………………. 109

4-8: رقیق كننده ها………………………………………………………………………………………….. 110

4-8-1: روش تهیه محلول رینگر…………………………………………………………………… 110

4-8-2: روش تهیه سرم فیزیولوژی………………………………………………………………… 111

4-8-3: روش تهیه محلول رقیق كننده آب پیتونه……………………………………………….. 111

4-9: روش شمارش میكروبها ……………………………………………………………………………. 111

4-10: شمارش و شناسایی كلی فرم ها…………………………………………………………………. 112

4-11: شناسایی اشریشیاكلی………………………………………………………………………………. 113

4-12: شناسایی سالمونلا…………………………………………………………………………………… 113

4-13: شناسایی استافیلوكوك اورئوس………………………………………………………………….. 114

4-13-1: طرز تهیه محیط كشت بردپاركر……………………………………………………………… 114

4-14: شناسایی یرسینیا…………………………………………………………………………………….. 116

4-15: شناسایی لیستریا…………………………………………………………………………………….. 117

4-15-1: محیط اختصاصی پالكام………………………………………………………………….. 118

4-16: حدمجاز میكروبی در بستنی……………………………………………………………………… 118

4-17: تستهای تشخیصی………………………………………………………………………………….. 119

فصل پنجم: نتیجه و بحث………………………………………………………………………………… 123

5-1: نتایج…………………………………………………………………………………………………….. 124

5-2: بحث…………………………………………………………………………………………………….. 138

5-3: پیشنهادات……………………………………………………………………………………………… 146

خلاصه لاتین…………………………………………………………………………………………………. 148

منابع……………………………………………………………………………………………………………. 149

برای دریافت پروژه اینجا کلیک کنید

دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word) دارای 24 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word) :

دانلود نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی در فایل ورد (word)

نگرش های مولکولی و فیزیولوژیکی به تحمل خشکسالی

آب عامل اصلی محدود کننده در کشاورزی جهان می باشد. در کل اغلب گیاهان زراعی، حتی به یک تنش ملایم از دست دادن آب نیز به دشت حساس هستند. با وجود این، چند جنس از گیاهان مختص آفریقای جنوبی وجود دارند که قابلیت بسیار بالا برای مقاومت در برابر از دست دادن آب و خشک شدن را دارند. به این جنس ها، گیاهان قیامت “resurrection Plants” گفته می شود.

ما از Xerophta viscose به عنوان نمونه گیاهان قیامت (تک لپه ای) استفاده کردیم تا ژن های مرتبط با تحمل فشار اسمزی را استخراج کنیم. چندین ژن که بصورت متمایز بیان می شوند، در سطوح بیوشیمایی و ملکولی مورد مطالعه قرار گرفتند. این ژنها همان هایی هستند که قابلیت عملکردی خوبی به اشریشیاکلی در شرایط تنش اسمزی می دهند. ما در این مقاله از این آزمایش به عنوان پایه ای برای بحث درباره نگرش های ملکولی و فیزیولوژیکی به تحل خشکسالی، استفاده خواهیم کرد.

(osmoprotectants)، آبسیزیک اسید (ABA) و عوامل رونویسی

مقدمه:

آب یک جزء مهم و اساسی در متابولیسم تمام ارگانیسم های رانده است. آب، انجام شدن بسیاری از واکنش های حیاتی زیست شناختی را بوسیله دارا بودن خصوصیاتی نظیر حلالیت، فراهم کردن محیط انتقال، سرد کردن محیط از راه تبخیر، تسهیل می کند. (Bohert et al., 1995).

در گیاهان و سایر فتواتوتروف ها، آب نقش مهمی در فراهم کردن انرژی مورد نیاز برای پیشبرد فتوسنتز دارد. ملکولهای آب، طی فرآیندی بنام اتولیز شکسته شده و الکترونهایی بر جای می گذارند که این الکترونها برای به چرخه درآوردن انرژی نوری ذخیره شده در فتوسیستم II ضروری می باشند. (Salisbury an Ross, 1992a)

یکی از پیامدهای مهم تنش خشکی، از دست دادن آب پروتوپلاسمی است که منجر به افزایش غلظت یونهایی مانند می شود. در غلظت های بالا چنین یونهایی به طور موثری مانع عملکرد متابولیکی می شوند (Hartung et al., 1998). همچنین افزایش غلظت اجزای تشکیل دهنده پروتوپلاسم و از دست دادن آب سلول باعث ایجاد وضعیت خاصی به نام «حالت شیشه ای: glassy state» می شود. در این حالت، ویسکوزیته مایع موجود در داخل سلول بیشتر می شود که در نتیجه باعث افزایش احتمال برهم کنش های مولکولی و واسرشت شدن پروتئین ها و فیوژن غشا می شوند. (Hartung et la., 1998; Hoekstra et al., 2001).

بنابراین گیاه برای حفظ تورگور سلولی و عملکردهای متابولیکی نیاز به بیان ژنهای خاصی دارد. گروه تحقیقاتی ما می کوشد گیاهان تراژنی زراعی و همچنین وحشی را که قادر به مقاوت در برابر خشکی باشند، ایجاد کند. منبع ژنها گیاهی به نام Xerophyta viscose (Baker) از خانواده Vello=iaceae است که متعلق به گروه کوچکی از نهاندانگان می باشد. این گیاه به علت قابلیت فوق العاده تحمل خشکی به «گیاه قیامت» ملقب شده است (Farrant, 2000, Gaff, 1977).

این گیاه (X. viscose) تا 5 درصد محتوای آب نسبی (RWC) می تواند آب از دست دهد و آبیاری مجدد این گیاه تقریباً به مدت 80 ساعت آنرا سیراب کرده و گیاه فعالیت های یزیولوژیکی خود را از سر می گیرد. (Sherwin and Farront, 1998).

ژنهایی که در این مقاله مورد بررسی قرار خواهند گرفت، شامل موارد زیر هستند: (XVPer 1 (کد کننده یک آنتی اکسیدان)، VATP1XV (کد کننده یک پروتئین زیر واحدی C مانند از آنزیم –H+ آدنوزین تری فسفاتاز)، XVGOLS (کد کننده یک گالاکتینول سنتاز)، ALDRXV4 (کد کننده یک آلدوز ردوکتاز)، XVSAP1 (کد کننده یک پروتئین متصل شونده به غشای سلولی) و DREB1A (کد کننده یک عامل رونویسی). برای تعیین اثرات ناشی از بیان این ژنها در تک لپه ای ها، آنها را به گیاه علفی بنام Digitaria sanguinalis انتقال دادیم و برای انتقال این ژنها خودمان یک سیستم انتقال طراحی کرده ایم (chen et al., 1998). سپس اگر نتایج مثبت باشند، ژنها به محصولات زراعی مانند ذرت (Zea mays) نیز منتقل خواهند شد. برای انجام چنین کاری بر روی دو لپه ای ها، ما نخست آن ژن ها را به Arabidopsis thaliana و Nicotina tobacum منتقل می کنیم.

پدیده تحمل خشکی یک پدیده پیچیده است که شامل بیان سازمان یافته ژنهای زیادی است (Walters et la., 2002) به عبارت دیگر، برای بدست آوردن گیاهان مقاوم در برابر خشکی، چند ژن باید به طور همزمان بیان شوند (Co-expression).

به عنوان مثال، بیان XVPer1، که به نظر می رسد DNA را در برابر گونه های فعال اکسیژن محافظت می کند، همزمان با بیان XVSAP1، که احتمالاً از تراوایی غشا جلوگیری می کند، همراه با بیان XVGOLS و ALDRXV4 که هر دو محافظت کننده اسمزی هستند، مجموعه ای از پروتئین های مرتبط به هم را نتیجه می دهد که با همکاری یکدیگر خصوصیت مقاومت در برابر خشکی را نتیجه می دهند.

برخی تغییرات ساختاری و فیزیولوژیکی ایجاد شده در سطح سلولها و در نتیجه در تمام پیکر گیاه از آنجائیکه پاسخ گیاهان به خشکی پیچیده و مختلف است، بنظر نمی رسد که فقط یک ژن در ایجاد تحمل خشکی نقش داشته باشد. بنابراین نیاز به درک پاسخ فیزیولوژیکی گیاهان تحت شرایط کمبود آب از اهمیت خاصی برخوردار است. (رجوع شود به Alpert and Oliver, 2002; Levitt, 1980, Walters et la. 2002 برخلاف گیاهان عادی، که پتانسیل آب را بالاتر از محیط حفظ می کنند و تلاش می کنند به فعالیت خود در دوره های کمبود آب ادامه دهند، گیاهان مقاوم خشکی یک استراتژی کاملاً متفاوت را به کار می گیرند: بافت های زنده تمام آب آزاد خود را از دست می دهند و سپس به طور آنی آب در دسترس بافت ها قرار می گیرد. این توانایی غیرعادی برای بقا در فقدان شدید آب در بافتهای زنده فقط در 100 نهاندانه مشاهده شده است (Gaff, 1977). اگر چه گیاهان قیامت ارزش اقتصادی چندانی برای کشاورزی ندارند، فهم بیشتر این پدیده می تواند نگرشهایی در مکانیسم های ممکن برای بهبود مقاومت گیاهان زراعی، ایجاد کند. در واقع روشهای زیادی وجود دارد که بوسیله آنها گیاهان مختلف به خشکسالی پاسخ می دهند (خلاصه شده در نمودار 1)

هستند (مثل ذرت)، باشد.

پایداری غشای سلولی

غشای سلولی نقش مهمی در حفظ انسجام سلولی، شرکت در انتقال سیگنالها، و در همئوستازی یونی در شرایط تنش خشکی بر عهده دارد. شوک اسمزی به سلولهای حساس به اسمز منجر به آسیب جبران ناپذیر غشای سلولی می شود. از سوی دیگر سلولهای مقاوم اسمزی اگر دارای مکانیسم های درونی شرکت کننده در پایداری غشا باشند می توانند دقت تنش آب زنده بمانند. شوک اسمزی شامل یک تغییر جزئی القاء شده بوسله دوگانه دوتسی در غشاء است که در هنگام شروع خشک شدن ظاهر می شود و نشان داده شده است که عملکرد سیگنالی دارد. سیگنال القاء شده بوسیله تغییر غشاء منجر به بیان پروتئین های فراوان embrycgenesis متأخر و پروتئین های شوک حرارتی در دانه ها می شوند. در طی دهیدراته شدن، ترکیبات دوگانه دوست سیتوپلاسمی از لحاظ غلظت و partition در غشاء افزایش می یابند و باعث اختلال در هم سلولهای حساس و هم سلولهای مقاوم می شوند. در مرحله میانی، در سلولهای مقاوم، حضور محلولها (قندها) سطح غشار را هیدراته نگه می داد رو از fusion غشا جلوگیری می کند. پایین تر از 0.3 گرم آب در g1 وزن خشک سلولی، ملکولهای قند در سلولهای مقاوم آب را در پوشش هیدراسیون غشا جاسازی می کنند و در نتیجه فضای بین ملکولهای فسفولیپید را حفظ می کنند.

Grawe et la., 2002 پینشهاد کرده است که یک CDNA، X VSAP1 از مجموعه CDNA استخراج شده از برگهای دهیدراته شده X. viscosa، نقشی در پایداری غشاء ایفا می کند. XVSAP1 خصوصیات مشترک زیادی با خانواده انتقال دهنده های k+ دارد. XVSAP1 پیش بینی شده شامل یک پروتئین سیار آبگریز با دو مکان برای اتصال چربی سیپوپروتئین به غشا می باشد. حضور این مکان ها مفهومی را تقویت می کند که بیان می کند: XVSAP1 به صورت کاملاً نزدیک با غشای سلولی ارتباط دارد و می تواند یکی از ترکیبات شکرت کننده در تعمیر آسیب غشایی ناشی از کمبود آب باشد.

بیان ژنهای پاسخی به تنش توسط مکان یابی عوامل رونویسی

ژنهای القاء شده در شرایط تنش کمبود آب می توانند به دو گروه تقسیم شوند. الوی پروتئین هایی را که مستقیماً در حفاظت نقش دارند و دومی پروتئین هایی را که در تنظیم transduction سیگنالی و بیان ژن نقش دارند، کد می کند. بعد از احساس کمبود آب توسط سلول، مکانیسم سیگنالی باید فعال شود تا ژنهای خاصی را برانگیخته کند. شرایط مختلف، ژنهای القاء شده توسط تنش مختلفی را برانگیخته می کند و بنابراین باید چندین مکانیسم سیگنالی مختلف وجود داشته باشد.یکی از سیگنال های اصلی عمل کننده در XVSAP1 تنش آب، هورمون گیاهی آبسیزیک اسید، ABA، است. مطالعات روی ABA، نشان داده است که این هورمون در چندین فرآیند فیزیولوژیکی و تکاملی مختلف (که این فرآیندها بر روی فعالیت های زراعی مانند بلوغ جنین و جوانه زنی تأثیر می گذارند)، علاوه بر پاسخ بافت های زنده و تنش اسمزی، وساطت می کند. ABA در نتیجه تنش آب افزایش پیدا می کند و نقش های مهمی در مقاومت گیاهان در برابر خشکی، شوری بالا و سرما دارد.

الگوهای بیان ژن های القا شده بوسیله خشکی پیچیده اند. بعضی از ژنها خیلی سریع به تنش پاسخ می دهند در حالیکه، بعضی دیگر به آهستگی بعد از انباشته شدن ABA برانگیخته می شوند. اکثر ژنهایی که به خشکی پاسخ می دهند همچنین بوسیله کاربرد ABA exogenous برانگیخته می شوند. برخی از ژنها وجود دارند که بوسیله تنش خشکی برانگیخته می شوند اما در هنگام مواجه شدن با exogenous ABA پاسخی نمی دهند. این یافته ها وجود هم زمان جریانها آبشاری سیگنالهای وابسته به ABA و مستقل از ABA را بین سیگنال اولیه تنش خشکی یا سرما و یان ژنهای خاص را نشان می دهند. این ژنهای القاء شونده بوسیله دهیدراته شدن شامل عناصر بالقوه پاسخ دهنده به ABA (ABREها) با تولای (Py ACGT GGC) در ناحیه پروموتور خود هستند. یک ABRE به عنوان یک عنصر DNA Cis-acting شرکت کننده در بیان ژنهای تنظیم شده بوسیله ABA عمل می کند و اولین بار در Em گندم و ژنهای rab برنج شناسائی شده بود. یک پروتئین متصل شونده به DNA و ABRE بنام EmBP-1 نشان داده شده است که یک پروتئین Bzip را کد می کند. G-box موتیف ABRE را مجتمع می کند و در تنظیم ژنها گیاه در شرایط مختلف محیطی عمل می کند. یک عنصر جفت شونده مورد نیاز است تا بتوان عملکرد ABRE را که یک مجموعه پاسخی از به ABA را تشکیل می دهد، در تنظیم ژن HVA22 مشخص کرد. سایر عناصر Cis-acting که در بیان ژنهای پاسخی به ABA، نه فقط در شرایط تنش خشکی بلکه همچنین درخشک شدن دانه عمل می کنند. جعبه Sph و جایگاه های اتصال MYC, MYB در ژن Arabilopsis rd22 می باشند. اخیراً یک عامل رونویسی (CPR18) ا زگیاه قیامت Craterostigma plantagineum که به ناحیه پروموتوری الزامی برای بیان با واسطه ABA ژن CdeT27-45 متصل می شود، استخراج شده است. این ژن دارای یک ناحیه Cis-regulatory 29 جفت بازی (AAGCCCAAATTTCACAGCCCGATA) است که در پروموتور ژن Cde27-45 از C.plantagineum موجود است.

برای دریافت پروژه اینجا کلیک کنید

دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word) دارای 54 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word) :

پایان نامه عکاسی با موضوع “دانلود عکاسی ، مکاتب و روش های آن در فایل ورد (word)”

فصل اول : کلیات تحقیق
فصل دوم : پیشینه تاریخی
فصل سوم : تحقیق

مقدمه :
قرن بیستم عصر رسانه ها و ارتباطات است . میلیونها نفر از مردم جهان ، هر روز از طریق عکس و تصویر از جریان رویدادها و تحولات سیاسی ، علمی و هنری آگاه می شوند .
رسانه ها با بهره گیری از عکس و تصویر ، در ابعاد مختلف گاه به شکل روزنامه ، مجله ، کتاب و گاه به صورت اسلاید ، فیلم ، تلویزیون ، ویدئو ، همواره در رشد آگاهی عمومی نقش انکار ناپذیری داشته اند. اگر انسان قدم بر کره ماه می گذارد یا در اعماق اقیانوس ها کند و کاو می کند ، عکس و تصویر با چشم ناظر ، همگام و همراه است و در ثبت لحظات حساس و با شکوه به ما مدد می رساند.
در این رساله می خواهیم به مختصری از هنر عکاسی و سبکها و مکاتب آن به چشمه کوچکی از آن اشاره کنیم و بتوانم به علم خود بیافزاییم…

بیان مسئله:
عکاسی یکی از بزرگترین اختراعات بشری است که فناوری در موارد متعددی تکامل و پیشرفت خود را مرهون آن است . از سوی دیگر جلوه های هنری آن افق دید واقع گرایانه و وسیع تری را از جهان رمز آلود در فراسوی دیدگانمان تصویر می کشد. در این پژوهش به این مهم دست خواهیم یافت که عکاسی چگونه در جهان رشد و نمو یافته است و به راستی کدام جنبه و جلوه آن در زندگی پررنگتر و کاربردی تر است؟ و چه بهره هایی بشر از آن برده است.
ضرورت مسئله :
در این پژوهش کسب معلوماتی جزئی از کلیت است و همچنین پاسخ به این سئوال که زاویه دید هنرمندانه یک عکاس حرفه ای چگونه بوده است که حتی بعد از گذشت سالیان متمادی اثر هنری وی هنوز خیره کننده و تحسین برانگیز است .
هدف مسئله :
تلفیق روش های سنتی و امروزی با یکدیگر و کاربرد آن و دیگر هنرها ، همچنین افزایش خلاقیت در راستای حرفه خود و افزایش دانش علاقه مندان این هنر

پرسش های مسئله :

فتو مونتاژ چیست ؟

جنبه های روانشناختی پرتره پیست ؟

عکاسی مد چیست ؟

عکاسی ذهنی چیست ؟

عکاسی در باهاوس چگونه بودهاست ؟

چه تاثیری سورر ئالیسم بر عکاسی گذاشته است ؟

عکاسی تبلیغاتی چیست ؟

هنر عکاسی در حیات وحش چگونه است ؟

عکاسی هنری چیست ؟

چه تاثیر فتو شاپ برعکاسی دارد ؟

عکاسی خلاق چیست ؟

پاپ آرت چیست و چه تاثیری بر عکاسی داشت ؟

عکس رو پوستر چه تاثیری دارد ؟

زاویه دید در عکس چه تاثیری بر کاربرد آن در صفحه آرایی دارد ؟

عکاسی ژورنالیستی چیست ؟

برای دریافت پروژه اینجا کلیک کنید

دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word) دارای 19 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word) :

بررسی ریاضی(سیستم اعداد مانده‌ای)

سیستم اعداد مانده‌ای (باقیمانده)

سیستم اعداد مانده‌ای یك سیستم اعداد صحیح است، كه مهمترین ویژگی‌اش بطور ذاتی انتقال رقم نقلی مجازی در جمع و ضرب و تفریق‌هاست، همچنین نتجه جمع و تفریق و ضرب اعداد ما در مرحله اول بدون در نظر گرفتن طول اعداد مشخص می‌شود، متأسفانه در سیستم اعداد مانده‌ای عملیات ریاضی دیگری مانند تقسیم و مقایسه و شناسایی علامت خیلی پیچیده و كند هستند از مشكلات دیگر سیستم اعداد مانده‌ای این است كه چون با سیستم اعداد صحیح كار می‌كند در نتیجه نمایش اعداد اعشاری در سیستم اعداد مانده‌ای خیلی ناجور است با توجه به خواص سیستم اعداد مانده‌ای نتیجه می‌گیریم كه در اهداف عمومی كامپیوترها (ماشین حساب‌ها) به صورت كاملاً جدی نمی‌تواند مطرح بشود. بهرحال ، برای بعضی از كاربرها كه اهداف خاصی دارند مثل بسیاری از انواع فیلترهای دیجیتال، تعداد جمع و ضرب‌هایی كه اساساً بزرگتر تعداد و درخواست بزرگی دامنه و شناسایی سرریز، تقسیم و شبیه این‌ها، سیستم اعداد باقیمانده خیلی جذاب و جالب می‌تواند باشد.

1-1) مقدمه

سیستم اعدادمانده‌ای اساساً بوسیله یك مبنای چندتائی (N – تائی) و نه یك مبنای واحد مثل از اعداد صحیح مشخص می‌شود. هر كدام از ها باقیمانده پس از تقسیم یك عدد بر آن‌ها است.عدد صیح X در سیستم اعداد مانده‌ای بوسیله یك N -تائی مثل نمایش داده می‌شود كه هر یك عدد غیرمنفی صحیح است كه در رابطه زیر صادق است:

X

0

1

0

1

0

1

0

1

0

1

0

1

0

2

0

1

2

0

1

2

0

1

2

0

1

2

-4

-3

-2

-1

0

1

2

3

4

5

6

7

8

جدول 1-1 نمایش اعداد در سیستم اعداد مانده‌ای به پیمانه‌

بزرگترین عدد صحیحی است بطوریكه معروف است به باقیمانده X به پیمانه Mi ، و در روش نوشتن اعداد هر دو و با یك مفهوم استفاده می‌شوند.

مثال 1-1 سیستم اعدادمانده‌ای 2- باقیمانده‌ای با پیمانه‌های را ملاحظه كنید در این سیستم نمایش عدد صحیح x=5 به صورت نمایش داده می‌شود كه و از رابطه‌های زیر بدست می‌آیند.

چونكه

چونكه

بنابراین در این سیستم اعداد مانده‌ای با پیمانه‌های و عدد صحیح 5 به صورت (2,1) نشان داده می‌شود.

عدد X لزوماً نباید یك عدد صحیح مثبت باشد بلكه می‌تواند عدد صیح منفی هم باشد برای مثال اگر X=-2 باشد آنگاه

چونكه

چونكه

نكته‌ای كه در اینجا وجود دارد این است كه ها مثبت تعریف می شوند .

بنابراین عدد صیح -2 در سیستم اعداد مانده‌ای با پیمانه‌های و بصورت نمایش داده می‌شود.

جدول 1-1 اعداد صحیح در محدوده [-4,8] را در سیستم اعداد مانده‌ای به پیمانه نمایش داده است.

همانطور كه از جدول 1-1 مشخص است نمایش مانده‌ای یك عدد صحیح منحصر بفرد است در حالی كه بر عكس این مطلب درست نیست و نمایش صحیح دو یا چند عددمانده‌ای ممكن است یكسان باشد برای مثال نمایش صحیح (1،1) هم عد یك می‌شود و هم عدد هفت، پس در نتیجه ما باید دامنه اعدادی را كه نمایش داده می شوند محدود كنیم، همنطور كه از جدول 1-1 مشخص می‌شود نمایش مانده‌ای دوره‌ای است و تكرار می‌شود و در اینجا محدوده تكرارش شش است، ما در سیستم اعداد مانده‌ای به پیمانه فقط شش نمایش مختلف دادیم چونكه دو مقدار مختلف سه مدقار مختلف می‌توانند به خود بگیرند، بنابراین ما باید ناحیه نمایش را به شش عدد محدود بكنیم، دو ناحیه‌ممكن در جدول مشخص شده‌اند، اولی و دومی است.

در حالت كلی در سیستم اعدادمانده‌ای می‌توان گفت كه تعداد نمایش‌های غیرتكراری برابر است با كوچكترین مضرب مشترك پیمانه‌‌ها، كه به صورت زیر نمایش داده می‌شود.

مثال 2-1

برای جمع دو عدد y=2 , x=1 در سیستم اعداد مانده‌ای به پیمانه‌ ، اولین كاری كه انجام می‌دهیم این است كه هر كدام از این اعداد را در سیستم اعداد مانده‌ای با این پیمانه نمایش می‌دهیم كه نمایش این اعداد به ترتیب به صورت (1 ، 1) و (0 ، 2) می‌باشد.

تتیجه نهایی برابر (1 ، 0) در سیستم اعداد مانده‌ای با پیمانه (3,2) است كه نمایشگر عدد 3 می‌باشد. ضرب دو عدد X و ‎ در هم نیز به صورت زیر است.

نتیجه ضرب X و Y در همدیگر در این سیستم (2,0) می‌شود كه نمایشگر عدد 2 می‌باشد.

برای انجام عمل تفریق اول ما معكوس جمع را تعریف می‌كنیم، معكوس جمع عدد c به پیمانه را به این صورت تعریف می‌كنیم.

چونكه

برای مثال

به بیانی دیگر، معكوس جمع یك عدد را می‌تواند مكمل باقیمانده نسبت به پیمانه‌اش باشد و سپس در ادامه معادله تفریق را به صورت زیر تعریف می‌كنیم.

در اینجا از تعریف معكوس جمع استفاده می‌كنیم و به شكلی دیگر كه در پایین آمده عمل تفریق می‌نویسم.

برای مثال اگر دو عدد Y=3 , X=5 در سیستم اعداد مانده‌ای با پیمانه داشته باشیم آنوقت عمل تفریق x-y به صورت زیر انجام می‌شود.

كه (2,0) نمایشگر مقدار2 می‌باشد.

مثال 3-1

سیستم اعداد مانده‌ای با چهار پیمانه (7,5,3,2) = را در نظر می‌‌گیریم در این سیستم‌ها همه پیمانه‌ها دوبه دو نسبت به هم اول هستند پس

حال عمل ضرب و جمع دو عدد X=3 و Y=4 را در این سیستم انجام می‌دهیم كه اعداد X=3 و Y=4 در این سیستم به ترتیب با (4,4,1,0) , (3,3,0,1) نمایش داده می شوند .

عمل جمع و ضرب این دو عدد در این سیستم بدینگونه انجام می‎شود.

2)

3

5

(7

2)

3

5

(7

1)

0

3

(3

3

1)

0

3

(3

3

0)

1

4

(4

× 4

0)

1

4

(4

× 4

0)

0

12

(12

12

1)

1

7

(7

7

0)

0

2

(5

1)

1

2

(0

اعداد (5,2,0,0) و (0,2,1,1) در سیستم اعداد مانده‌ای به پیمانه (7,5,3,2) = به ترتیب نمایشگر اعداد 12 و 7 هستند كه جواب درست عملیات جمع و ضرب ما می‌باشند. اما وقتی كه ما جمع دو عدد 7 و 206 را كه در این سیستم اعداد مانده‌ای به ترتیب با (0,2,1,1) و (3,1,2,0) انجام می‌دهیم عدد (3 , 3 , 0 , 1) در این سیستم اعداد مانده‌ای بدست می‌آید كه نمایشگر عدد 3 می‌باشد.

دانلود بررسی ریاضی(سیستم اعداد مانده‌ای) در فایل ورد (word)
فهرست

عنوان صفحه

1-1) مقدمه………………………………………………………………………………………… 2

2-1) عملیات ریاضی……………………………………………………………………………. 7

1-2-1) معكوس ضرب……………………………………………………………………….. 10

3-1) سیستم اعدادمبنای در هم وابسطه………………………………………………… 12

4-1) تبدیل اعداد به سیستم اعداد مانده‌ای و برعكس………………………………. 22

1-4-1-) تبدیل اعداد از سیستم باینری به سیستم مانده‌ای …………………….. 24

5-1) انتخاب پیمانه………………………………………………………………………………. 26

برای دریافت پروژه اینجا کلیک کنید

دانلود بررسی ایزومری در اكسیم در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود بررسی ایزومری در اكسیم در فایل ورد (word) دارای 126 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود بررسی ایزومری در اكسیم در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود بررسی ایزومری در اكسیم در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود بررسی ایزومری در اكسیم در فایل ورد (word) :

دانلود بررسی ایزومری در اكسیم در فایل ورد (word)

مقدمه:

با پیدایش شیمی داروئی با تلفیق شیمی آلی سنتیتك، جنبه‌های فارماكلوژیك و اهداف بالینی به تحولی شگرف در علم داروسازی منتهی شد. تهیه تركیبات رهبر توسط علم شیمی و تطبیق آن با مقاصد درمانی بوسیله مطالعات بالینی مسیر تحقیقات را به سمت تولید دسته‌های داروئی جدید سوق داده است. بی‌شك موفقیت علم پزشكی در سال‌های اخیر تا حد زیادی مرهون این كشفیات است. البته پیشرفت در این زمینه به دور از مشكلات نبوده و عدم هماهنگی واحدهای مختلف از جمله «بالینی» در پذیرش و استفاده از داروهای جدید و یا بهره‌مند نبودن از روش‌های كنترل‌ شده موانعی بر سر راه تحقیقات به حساب می‌آمدند.

پزشكی امروز جهت بكارگیری روش‌های مطلوب به داروهائی با طیف اثر انتخابی‌تر و عوارض جانبی كمتر نیازمند است و این امر به جز در سایه تلاش‌های متخصصان شیمی داروئی محقق نخواهد شد، روندی كه در تمام طول تاریخ علی‌رغم معضلات محدودیت‌ها و موانع بیشمار به همت دانشمندانی فرزانه به بهترین نحو پیش رفته و در آینده نیز تداوم خواهد یافت.

كلیات:

1-1- اكسیم‌ها و كاربرد آنها:

اكسیم‌ها به نحو گستر‌ده‌ای در خالص‌سازی و شناسائی تركیبات كربونیل‌دار استفاده می‌شوند. [1].

همچنین گروه عاملی اكسیم، آمید و لاكتام با داشتن خواص داروئی و بیولوژیكی متفاوت، كاربردی وسیع در فرآیندهای بیوسنتزی، كشاورزی، داروسازی و ساخت رنگ‌ها در صنعت دارند [2].

تركیبات كربونیل محافظت شده نظیر اكسیم‌ها به دلیل سهولت تهیه و پایداری خوب برای شیمیدانان آلی از ارزش زیادی برخوردارند و روش‌های مختلفی برای محافظت زدائی آنها گزارش شده است. [5-3 ]. اكسیم‌ها حد واسط‌های مهمی در شیمی آلی‌اند كه در تهیه آمین‌ها [6]، آمیدها [7] یا لاكتام‌ها [8] و شناسایی آلدئیدها و كتن‌ها [1] بكار می‌روند.

همچنین، همانطور كه گفته شد، عامل اكسیم و مشتقات آن در اغلب تركیبات داروئی وجود دارند [9].

اكسیم‌ها كاربردهای درمانی وسیعی دارند از جمله این كاربردها:

– به عنوان آنتی دوت مسمومیت با گازهای جنگی

– به عنوان آنتی دوت مسمومیت با سموم ارگانو فسفره

– به عنوان ضد قارچ

– به عنوان علف‌كش

– به عنوان ضد كرم

– و …

در این بخش سعی می‌گردد آثار فارماكولوژیك اكسیم‌ها و كاربردهای آنها بر اساس مقالات بدست آمده بررسی گردد.

1-1-1- اثر اكسیم‌ها به عنوان آنتی دوت گازهای جنگی:

آسیب ناشی از مواد شیمیائی در عملیات نظامی برای اولین بار در جنگ جهانی اول (1918-1914) زمانی كه گاز كلرین Chlorin Gase در یك باد ملایم از سیلندرهای بزرگ به محیط خارج انتشار یافت صورت گرفت. از آن پس مواد شیمیائی متعددی در جنگ جهانی اول بكار رفت در آن زمان از مواد تاول زائی به نام گاز خردل Mustardgas استفاده می‌شد كه بالاترین آسیب جنگی را در آن زمان ایجاد كرد [10].

در اواخر جنگ جهانی دوم گازهای اعصاب یا Nerve Gases توسط آلمانی‌ها كشف گردیدند. به همین دلیل گازهای عصبی سارین، سومان و تابون را عوامل G – می‌نامند. در سال 1955 دسته بزرگتری از گازهای عصبی در یك لابراتوار تجارتی تولید حشره‌كش كشف گردید. این تركیبات تازه با عنوان عوامل V – شناخته شدند.

اكثر این تركیبات در حین آزمایشاتی كه برای تهیه حشره‌كش‌های ارگانو فسفره صورت می‌گرفت سنتز شدند. در این قسمت مهمترین این تركیبات را مورد مطالعه قرار می‌دهیم:

تابون GA:

تابون (TABUN) در اواخر جنگ جهانی دوم توسط آلمان‌ها ساخته شد و در پایان جنگ یكی از تأسیسات تولیدی آن بدست روس‌ها افتاد. قدرت تابون حدوداً نصف سارین و یك چهارم سومان است.

LD50 آن از راه خوراكی 400 میلی‌گرم به ازای هر فرد، از طریق جلدی 1000 میلی‌گرم، Lct50 (از راه تنفس) آن 400 میلی‌گرم در دقیقه در مترمكعب می‌باشد.

تابون به شكل مایع و گاز قابل انتشار بوده و پایداری آن در هوای (هوای‌ آفتابی با وجود برف زمین) از 1 تا 2 هفته، در (هوای آفتابی توام با نسیم) از 1 تا 3 روز و در (هوای مرطوب توام با باد) 15 دقیقه تا 16 ساعت می‌باشد.

شكل 1-1- ساختمان گاز جنگی تابون

اگر چه قدرت اثر تابون به اندازه عوامل سمی دیگر نیست. لیكن بعلت پایداری نسبتاً زیاد در صحنه عملیات از نظر تاكتیكی حائز اهمیت است. با وجود تجزیه سریع آن در حضور رطوبت، در نتیجه عمل هیدرولیز سیانید هیدروژن ایجاد می‌شود كه خود گاز خفه كننده خطرناكی محسوب می‌شود. همچنین بر اثر تركیب آن با محلول‌های رفع آلودگی حاوی كلر، تركیب شدیداً سمی كلرید سیانوژن تولید می‌شود [11].

سارین GB:

این تركیب (SARIN) ظاهراً یكی از مهم‌ترین عوامل رده G از گازهای عصبی می‌باشد. در صورت خالص بودن، مایع بی‌رنگی است كه در درجه حرارت‌های عادی فرار بوده و گازی بی‌رنگ و بی‌بو ایجاد می‌كند. سارین به هر نسبتی با آب مخلوط شده و در محلول‌های قلیائی قوی یعنی با PH بالا سریعاً هیدرولیز می‌گردد. مواد حاصل از هیدرولیز عموماً غیر سمی هستند.

پایداری اكسیم در محلول‌های آبی یك ویژگی شیمیائی بسیار مهم است، زیرا در كاربردهای درمانی باید از پیش آماده و نگهداری شوند. پیرالیدوكسیم و اوبیدوكسیم و متوكسیم نسبتاً در آب پایدار هستند و می‌توانند به صورت محلول نگهداری شوند، HI-6 و HLO-7 در آب ناپایدار بوده و باید به صورت پودر‌های لیوفلیزه نگهداری شوند. این اكسیم‌ها به سرعت در محیط آبی تجزیه می‌شوند. نیمه عمر تجزیه 1 mM از محلول هر یكی از این H – اكسیم‌ها در حدود 12 ساعت است [11].

ب) فارماكوكینتیك اكسیم‌ها:

با توجه به اطلاعات تجربی اولیه غلظت پلاسمائی لازم برای مقابله با اثرات سمی تركیبات ارگانو فسفره در Invivo كه شامل بلاك نروماسكولار، برادی كاردی، هایپوتانسیون، نقصان تنفسی، تعیین شده بود. پس از آن این رقم به عنوان حداقل غلظت بسیاری از اكسیم‌ها صرفنظر از ماهیت و وزن مولكولی، برای ایجاد خاصیت آنتی‌دوتی آنها در نظر گرفته شد.

تزریق عضلانی پیرالیدوكسیم به داوطلبان انسان با دوز در زمان 5 تا 10 دقیقه غلظت پلاسمائی را ایجاد كرد و به مدت 50 تا 55 دقیقه سطوح بالاتر از این آستانه را حفظ نمود.

تزریق عضلانی HI-6 با مقادیر 250 یا 500 میلی گرم در عرض 4 تا 6 دقیقه غلظت پلاسمائی را ایجاد كرده و به ترتیب 125 و 200 دقیقه این غلظت را حفظ كردند.

به طور مشابه تزریق عضلانی اوبیدوكسیم با دوز غلظت پلاسمائی را در عرض 5 دقیقه ایجاد كرد و در حدود 2 تا3 ساعت آن را حفظ نمود. فارماكوكینتیك HLO-7 شبیه HI-6 است. Eyer و همكارانش نشان دادند میانگین نیمه عمر جذب HLO-7 در حدود 14 دقیقه پس از تزریق عضلانی است. حداكثر غلظت پلاسمائی حدوداً 30 دقیقه پس از تزریق ایجاد می‌شود و حذف آن با كینتیك درجه یك با نیمه عمر 45 دقیقه انجام می‌گیرد. لیكن در بعضی مقالات عنوان شده كه غلظت یك آستانه متصورانه برای تأثیر آنتی دوت در مقابل اثرات سمی ارگانو فسفره است.

شیلوف و كلمنت نشان داده‌اند كه غلظت پلاسمائی از HI-6 یا غلظت از پیرالیدوكسیم (‍Pralidoxime) می‌تواند 50 درصد رت‌ها را در مقابل دوز سه برابر LD50 سارین، بعد از تزریق آتروپین محافظت كند.

از طرف دیگر غلظت پلاسمائی از اوبیدوكسیم برای ایجاد اثرات مشابه لازم است. به همین دلیل غلظت پلاسمائی كه در سال 1961 به عنوان دوز آستانه در نظر گرفته شده نمی‌تواند برای تمامی اكسیم‌ها دقیق باشد و باید از نو محاسبه گردد [11].

ج) سمیت اكسیم‌ها:

اطلاعات دقیق در مورد خاصیت كشندگی اكسیم‌ها در جدول 1 خلاصه شده است. برای موش، LD50 (وریدی) پیرالیدوكسیم و HI-6 برابر است و بیشتر از دوز اوبیدوكسیم می‌باشد. در تزریق عضلانی نیز چنین ارتباطی وجود دارد و همگی آنها كمتر از LD50 متوكسیم هستند. به همین دلیل به نظر می‌رسد متوكسیم كمترین سمیت (بیشترین LD50) را داشته باشد. پس از آن به ترتیب پیرالیدوكسیم، HI-6 در نهایت اوبیدوكسیم با بیشترین سمیت قرار دارند.

در رت LD50 (وریدی) پیرالیدوكسیم كمی بیش از اوبیدوكسیم است. در تزریق عضلانی نیز چنین ارتباطی وجود داشته و كمتر از LD50 معادل از متوكسیم، HI-6 و HLO-7 است. به همین دلیل می‌توان نتیجه گرفت متوكسیم، HI-6 و HLO-7 سمیت كمتری نسبت به پیرالیدوكسیم دارد و اوبیدوكسیم بیشترین سمیت را از خود نشان می‌دهد.

در خوكچه هندی LD50 عضلانی در مورد پیرالیدوكسیم و HI-6 برابر بوده و بیشتر از اوبیدوكسیم می‌باشد. به طور مشابه LD50 وریدی پیرالیدوكسیم بیشتر از اوبیدوكسیم در خرگوش می‌باشد. در نتیجه اوبیدوكسیم بیشترین سمیت را در حیوانات كوچك آزمایشگاهی ایجاد می‌كند. فلج تنفسی عامل اصلی سمیت در آلدوكسیم‌های پیریدینی كه در اكسیم‌های رایج وجود دارد، می‌باشد. در نتیجه مرگ در اثر فلج تنفسی در مسمومیت با اكسیم‌ها بسیار متحمل است.

و) اثربخشی درمانی اكسیم‌ها:

اثربخشی درمان اكسیم‌ها معمولاً با نسبت حفاظتی LD50 تركیبات ارگانو فسفره در حیوان دریافت كننده درمان در مقایسه با LD50 در حیوان محافظت نشده تعیین می‌شود. بیشتر اطلاعات بدست آمده از تجربیاتی است كه در آنها از آتروپین و اكسیم به عنوان آنتی‌دوت با هم استفاده شده زیرا این روش در پروتوكل درمانی نظامی پذیرفته شده است و اثرات بهتری نسبت به استفاده جداگانه هر یك از این تركیبات دارد.

تابون در برابر اثرات حفاظتی اكسیم‌ها در بسیاری از گونه ها از خود مقاومت نشان می‌دهد. اوبیدوكسیم نسبت به پیرالیدوكسیم و HI-6 در موش برتری دارد ولی در رت این گونه نیست. كارائی پیرالیدوكسیم و HI-6 در خوكچه هندی با یكدیگر قابل مقایسه است. در مورد اوبیدوكسیم اطلاعاتی در دسترس نیست.

این اطلاعات منتشر شده نشان می دهند كه تركیب داروهای آنتی كولینرژیك با اكسیم‌های رایج (پیرالیدوكسیم و اوبیدوكسیم) و یا H ـ اكسیم‌ها (HI-6) به میزان كافی در كاهش سمیت ناشی از تابون مؤثر نیست.

معكوس كردن اثرات زیان‌آور تابون بسیار دشوار است و این به علت وجود زوج الكترون آزادی است كه روی نیتروژن آمیدی قرار دارد كه حملات نوكلئوفیلیك اكسیم‌ها را تقریباً غیرممكن می‌سازد. افیكیسی اكسیم‌ها در مقابل سارین كه از كارهای تجربی بدست آمده وابسته به گونه حیوان است. بیشتر تحقیقات نشان می دهند. پیرالیدوكسیم و اوبیدوكسیم در این زمینه اثرات متوسط و قابل مقایسه‌ای در موش و رت و اثرات نسبتاً بالائی در خوكچه هندی دارند. HI-6 بسیار بیشتر از پیرالیدوكسیم و اوبیدوكسیم در موش و رت مؤثر است ولی در خوكچه هندی اثرات كمتری دارد. تركیب HI-6 به اضافه آتروپین نسبت به سومان صرفنظر از گونه حیوان به طور قابل ملاحظه‌ای مؤثر است.

پیرالیدوكسیم و اوبیدوكسیم در پستانداران قدرت محافظت كنندگی در برابر سمیت با دوز‌های فوق كشنده سومان را ندارند. سومان یكی از گازهای جنگی بسیار مقاوم به درمان‌های آنتی دوتی است زیرا در بدن به آهستگی آزاد شده و آنزیم استیل كولین استراز فسفونیله شده به سرعت دچار aging می‌شود. این aging سریع اثرات احیاكنندگی اكسیم‌ها را خنثی كند.

Vx به اثرات درمانی تمامی اكسیم‌ها جواب می‌دهد. تركیبات حاوی آتروپین و پیرالیدوسیم، اوبیدوكسیم یا HI-6 همگی به شدت در مقابل Vx در رت و به خوبی در موش مؤثر هستند.

پیرالیدوكسیم در خوكچه هندی قویاً علیه Vx مؤثر است.

دانلود بررسی ایزومری در اكسیم در فایل ورد (word)
فهرست مطالب

خلاصه فارسی

مقدمه………………………………………………………………………………………………… 1

فصل اول: كلیات

1-1- اكسیم‌ها و كاربرد آنها………………………………………………………………… 2

1-1-1- اثر اكسیم به عنوان آنتی دوت………………………………………………….. 4

الف) ساختار شیمیائی و ویژگی اكسیم‌ها………………………………………………… 11

ب) فارماكوكینتیك اكسیم‌ها…………………………………………………………………… 14

ج) سمیت اكسیم‌ها………………………………………………………………………………… 15

د) خاصیت فعالیت بخشی مجدد در In- Vitro…………………………………………… 17

هـ) خاصیت احیاكنندگی در In-Vivo………………………………………………………. 20

و) اثربخشی درمانی اكسیم‌ها………………………………………………………………… 25

ز) توصیه‌های بالینی…………………………………………………………………………….. 30

1-1-2- اثر اكسیم‌ها به عنوان آنتی دوت سموم ارگانو فسفره………………… 32

الف) مكانیزم عمل آفت كش‌های ارگانو فسفره………………………………………… 32

ب) تابلوی بالینی مسمومیت با آفت كش‌های ارگانو فسفره………………………… 34

ج) درمان مسمومیت با آفت كش‌های ارگانو فسفره………………………………….. 37

1-1-3- اكسیم با كاربرد علف‌كش………………………………………………………… 38

1-1-4- اثر ضد قارچی اكسیم‌ها………………………………………………………….. 39

الف) معرفی قارچ‌ها………………………………………………………………………………. 39

ب) شیمی درمانی بیماری‌های قارچی……………………………………………………… 41

ج) آزول‌های ضد قارچ………………………………………………………………………….. 43

د) فارماكوفور آزول‌های ضد قارچی……………………………………………………… 44

هـ) مكانیزم اثر آزول‌ها………………………………………………………………………… 48

و) طراحی آزول‌های جدید ضد قارچ (آنالوگ های اكسی كونازول)…………… 51

1-1-5- اثر اكسیم در درمان بیماری انگلی لشمانیوز……………………………… 55

1-1-6- تركیبات آنتی‌بیوتیك با ساختار اكسیم……………………………………….. 57

الف) تعریف آنتی‌بیوتیك‌ها……………………………………………………………………… 57

ب) منابع آنتی‌بیوتیك‌ها………………………………………………………………………….. 60

ج) مكانیزم اثر آنتی‌بیوتیك‌ها………………………………………………………………….. 60

د) آنتی‌بیوتیك‌های بتالاكتام……………………………………………………………………. 63

1-1-7- اثر اكسیم در درمان بیماری آلزایمر…………………………………………. 67

الف) علت‌شناسی بیماری آلزایمر……………………………………………………………. 68

ب) درمان بیماری آلزایمر……………………………………………………………………… 68

1-1-8- مشتقات اكسیم با خاصیت ضد تشنج………………………………………… 70

الف) فیزیوپاتولوژی صرع…………………………………………………………………….. 72

ب)اتیولوژی صرع………………………………………………………………………………… 74

ج) دارو درمانی صرع…………………………………………………………………………… 75

1-1-9- مشتقات اكسیم با خاصیت مهار كنندگی پمپ سدیم ـ پتاسیم……….. 78

1-1-10- اكسیم با خاصیت مهاركنندگی آنزیم Cytp450…………………………… 79

فصل دوم: بخش نظری

2-1- تلاش برای سنتز 2-(4-ترسیوبوتیل-1- سیكلوهگزنیل)-4- ترسیوبوتیل سیكلوهگزانون از 4- ترسیوبوتیل سیكلوهگزانون…………………………………………………………………………………….. 81

2-1-1- روش سنتز 2-(4- ترسیوبوتیل-1-سیكلوهگزنیل)-4-ترسیوبوتیل سیكلوهگزانون از 4- ترسیوبوتیل سیكلوهگزانون در محیط اسیدی……………………………………………………………. 82

2-1-2- روش سنتز 2-(4- ترسیوبوتیل-1-سیكلوهگزنیل)-4-ترسیوبوتیل سیكلوهگزانون از 4- ترسیوبوتیل سیكلوهگزانون در محیط اسیدی با حلال تولوئن82

2-1-3- روش سنتز 2-(4- ترسیوبوتیل-1-سیكلوهگزنیل)-4-ترسیوبوتیل سیكلوهگزانون از 4- ترسیوبوتیل سیكلوهگزانون در محیط بازی………………………………………………………………. 83

2-1-4- روش خالص سازی كتون سنتز شده……………………………………….. 84

الف) انتخاب حلال………………………………………………………………………………… 85

ب) انحلال……………………………………………………………………………………………. 86

ج) صاف كردن محلول داغ……………………………………………………………………. 87

د) تبلور………………………………………………………………………………………………. 87

هـ) صاف كردن…………………………………………………………………………………… 88

و) خشك كردن بلور‌ها………………………………………………………………………….. 89

2-2- تلاش برای سنتز اكسیم از 2-(4- ترسیوبوتیل-1- سیكلوهگزنیل)-4-ترسیوبوتیل سیكلوهگزانون 90

3-1- روش سنتز 2-(4- ترسیوبوتیل-1-سیكلوهگزنیل)-4-ترسیوبوتیل سیكلوهگزانون از 4- ترسیوبوتیل سیكلوهگزانون در محیط بازی……………………………………………………………………………………………………. 91

3-2- عمل جداسازی كتون مورد نظر توسط كریستال‌گیری مجدد……………. 92

3-3- طیف‌های كتون سنتز شده……………………………………………………………. 95

3-4- بررسی و نتیجه گیری…………………………………………………………………. 106

3-5- تلاش برای سنتز اكسیم از كتون ساخته شده در مرحله 3-1-………… 107

3-6- عمل جداسازی اكسیم مورد نظر توسط كریستال‌گیری مجدد………….. 108

3-7- طیف‌های اكسیم سنتز شده………………………………………………………….. 110

3-8- بررسی و نیتجه‌گیری………………………………………………………………….. 115

خلاصه انگلیسی…………………………………………………………………………………… 116

منابع…………………………………………………………………………………………………… 117

برای دریافت پروژه اینجا کلیک کنید

دانلود مقاله اثرات تنش خشكی در مراحل انتهای رشد ارقام بهاره كلزا در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود مقاله اثرات تنش خشكی در مراحل انتهای رشد ارقام بهاره كلزا در فایل ورد (word) دارای 35 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود مقاله اثرات تنش خشكی در مراحل انتهای رشد ارقام بهاره كلزا در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود مقاله اثرات تنش خشكی در مراحل انتهای رشد ارقام بهاره كلزا در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود مقاله اثرات تنش خشكی در مراحل انتهای رشد ارقام بهاره كلزا در فایل ورد (word) :

دانلود مقاله اثرات تنش خشكی در مراحل انتهای رشد ارقام بهاره كلزا در فایل ورد (word)

مقدمه:

این روزها جمله «وابستگی 90 درصدی روغن، ورشكستگی ملی» به واژه ای تكراری تبدیل شده و در هر محفل و نشریه ای این كلمات به كرات بیان می‎شود. این جمله زمانی حیرت انگیزتر می‎شود كه در كنار بحث خودكفائی گندم نیز قرار بگیرد. ایرانی كه تا چند سال پیش بزرگ ترین وارد كننده گندم جهان بود طی چند سال، تنها چند سال، به خودكفائی رسیده و حتی زمزمه های صادرات نیز به گوش می رسد. مسئولان جهاد كشاورزی طی همین سالها با توجه به این موفقیت به فكر برنامه ریزی برای تأمین نیازهای كشور به دانه های روغنی از داخل افتاده اند تا شاید روزی هم بتوان از این سرشكستگی ملی رهایی یافت. این مدیران امیدوارند اجرای طرح ده ساله دانه‌های روغنی نیز مثل گندم باعث افتخار و مباحاتشان شود (ماهنامه روغن نباتی، 1383 الف). كشور ایران معادل 000، 800 ، 164 هكتار مساحت دارد كه از این مقدار، 15 الی 18 میلیون هكتار شوره‌زار، 20 الی 22 میلیون هكتار بیابان و تقریباً یك میلیون هكتار نیمه خشك است. ایران با متوسط نزولات آسمانی 240 میلی متر كه از یك سوم میزان نزولات سالانه جهانی (700 میلی متر) كمتر می باشد، دارای اقلیم خشك و نیمه خشك است. در مناطق خشك، میزان باران سالانه، كمتر از تبخیر و تعرق بوده و بروز دوره خشكی در طول سال امری عادی است (كافی و همكاران، 1379 ب). تحقیقات انجام شده نشان داده است كه متوسط افت عملكرد سالیانه به واسطه خشكی در جهان 17 درصد بوده كه تا بیش از 70 درصد در هر سال می‎تواند افزایش یابد(Edmeades et al, 1994). با توجه به این موضوع كشاورزان و دست اندركاران كشور، اصولاً باید با تلاش فراوان و مدیریت صحیح و اقتصادی منابع آبی و استفاده بهینه از آب در تولید هر چه بیشتر محصولات زراعی، مشكل غذایی جمعیت را رفع سازند. دانه های روغنی پس از غلات، دومین ذخایر غذایی جهان را تشكیل می دهند. این محصولات علاوه بر دارا بودن ذخایر غنی اسیدهای چرب، حاوی پروتئین نیز می باشند (شیرانی راد و دهشیری، 1381). دانه های روغنی به دلیل تولید روغن های با كیفیت بالا و درصد زیادی از اسیدهای چرب و مرغوب از اهمیت شایانی در تغذیه انسان برخوردارند (آلیاری و همكاران، 1379). در حال حاضر، مصرف سرانه روغن خوراكی كشور بیش از 16 كیلوگرم برآورد شده است. لذا با توجه به جمعیت كشور، نیاز به حدود یك میلیون تن روغن در سال می‎باشد كه بیش از 90 درصد آن از طریق واردات تأمین می‎شود (شیرانی راد و دهشیری، 1381). میزان واردات روغن خام در سال 1382 در جدول (1-1) درج گردیده است

(ماهنامه روغن نباتی، 1383 ب). به این لحاظ، لزوم برنامه ریزی بلندمدت و منسجم با هدف نیل به خودكفائی در تولید روغن خوراكی غیرقابل انكار خواهد بود (شیرانی راد و دهشیری، 1381).

جدول(1-1) – میزان واردات روغن خام در سال 1382

ردیف

شماره تعرفه

نام كالا

وزن

ارزش دلاری

1

15071000

روغن خام سویا

777,431,497

436,268,054

2

15091000

روغن زیتون بكر

802,482

699,146

3

15111000

روغن خام نخل

53,108,436

25,127,238

4

15121100

روغن خام آفتابگردان

183,477,357

116,593,314

5

15122100

روغن خام پنبه دانه

4,647,000

2,879,924

6

15141100

روغن خام كلزا

19,973,625

12,374,815

جمع

1,039,440,397

593,942,491

مأخذ: (گمرك جمهوری اسلامی ایران)

در حال حاضر سالانه 2/1 میلیارد دلار صرف واردات روغن نباتی و كنجاله سویا می‎شود و اگر روند كنونی مصرف و رشد جمعیت ادامه یابد، تا چند سال آینده سالانه دو میلیارد دلار صرف واردات روغن خوراكی خواهد شد (ماهنامه روغن نباتی، 1383 ب).

در این میان، كلزا به عنوان یكی از مهم ترین گیاهان روغنی برای كشت در شرایط آب و هوایی كشور مورد توجه قرار گرفته است. تولید جهانی روغن كلزا در مقایسه با دیگر روغن های گیاهی در مقام دوم بعد از روغن سویا قرار دارد و میزان آن بیش از 42 میلیون تن می‎باشد. همچنین، پس از استحصال روغن، كنجاله باقی مانده سرشار از پروتئین بوده و برای تغذیه دام مناسب است (آلیاری و همكاران، 1379). با توجه به اینكه در حال حاضر میزان روغن تولیدی در داخل كشور ناچیز بوده و عمدتاً با كشت گیاهان سویا، آفتاب گردان، پنبه دانه، بادام زمینی، زیتون و كنجد تأمین می‎شود و همچنین با عنایت به اینكه همه ساله مقدار قابل توجهی از زمین های آبی و دیم كشور به منظور تقویت بنیه خاك، بدون كاشت باقی می ماند، لذا كلزا بویژه نوع پائیزه آن با داشتن بیش از 40% روغن و در حدود 40% پروتئین در كنجاله، از لحاظ زراعی می‎تواند در تناوب با غلات كه زراعت عمده كشور می باشد، قرار گیرد و سهم ارزنده ای را در رفع كمبود روغن گیاهی موردنیاز كشور ایفا كند (احمدی، 1371). یكی از عوامل بسیار مهم كه توسعه سطح زیر كشت و تولید موفقیت آمیز گیاه كلزا در كشور با خطر مواجه می سازد، كمبود رطوبت خاك در انتهای دوره رشد می‎باشد (شكاری، 1380). در دوره انتهایی رشد در فصل بهار در كلزا به دلیل همزمانی این گیاه با دیگر زراعت های اصلی از جمله غلات امكان فراهم نبودن آب (دوره خشكی) مهیاست. كم آبی از مهمترین عوامل محدود كننده رشد گیاهان و تولید آنها به حساب می‎آید و در حال حاضر، هیچ راه منطقی برای افزایش نزولات جوی در طول دوره های خشكی وجود ندارد. لذا بهترین راه مقابله با خشكی، به كارگیری عملیات زراعی مناسب و استفاده از ارقامی است كه تحمل به خشكی بیشتری داشته باشند (احمدی و جاویدفر، 1379).

تحقیق حاضر نیز به منظور بررسی اثرات تنش خشكی در مراحل انتهایی رشد ارقام بهاره كلزا انجام گرفت.

-6- خصوصیات گیاه شناسی

كلزا با نام علمی Brassica napus L. گیاهی است از خانواده چلیپائیان[1] و یكساله با عدد كروموزومی (38=n2) كه عمدتاً دارای تیپ‌های رشد بهاره ، پائیزه و بینابین می باشد. به طور كلی ویژگی‌های اندام‌های رویشی و زایشی آن به شرح زیر است:

1-6-1- ریشه

دارای یك ریشه اصلی عمودی و غالباً بلند و به شكل دوك می‌باشد كه قطر قسمت فوقانی آن به 1 تا 3 سانتی متر می رسد و تا عمق 80 سانتی متری خاك نفود می‌كند (شیرانی راد و دهشیری،1381). در شرایط آب و هوایی و زمین مناسب ریشه های جانبی رشد كرده و به شدت منشعب می‌شوند(حجازی،1379). این ریشه ها حجم عظیمی از خاك را در برگرفته و جذب رطوبت و مواد غذایی را برعهده دارند ( آلیاری و همكاران،1379). ریشه های این گیاه تا عمق 120 و.150 سانتی متری در زمین فرو می روند. البته نفوذ ریشه در زمین محدود است( حجازی، 1379). در خاك‌های سنگین رسی، عمق نفوذ ریشه كاملاً‌محدود می‌شود. عمق نفوذ ریشه و كشیدگی سیستم ریشه، نقش به سزایی در تحمل خشكی و استفاده بهینه از رطوبت ذخیره شده در خاك دارد. همچنین گیاه را در ارتفاع زیاد با كشت متراكم در مقابل بادهای شدید حفظ می كند (شیرانی راد و دهشیری، 1381). تحقیقات نشان داده اند كه سیستم ریشه ای كلزا اثرات مفیدی روی ساختمان خاك و نفوذ رطوبت دارند و نتیجه اش عملكرد دانه و پروتئین بالاتر در غلاتی است كه در تناوب با آن قرار می گیرند (Norton et al ,1999).

1-6-2- ساقه

كلزا یك ساقه اصلی تولید می كند كه از آن شاخه های زیادی منشعب می شوند (شیرانی راد و دهشیری،1381). ساقه ها معمولاً‌گرد، توپر،راست و سبز هستند كه با افزایش سن گیاه به زردی گرایش می‌یابند. در بیشتر مناطق، ارتفاع ساقه بین 80 تا 150 سانتی متر است، اما در استرالیا ارتفاع ساقه به 250 سانتی متر می رسد كه باعث بروز مشكلاتی در امر برداشت می شود. بنابراین واریته‌های پاكوتاه به سرعت رواج پیدا كرده اند (عاشوری،1380). ساقه در مرحله روزت[2] ، به شكل كوتاه با میان‌گر‌ه های فشرده ( با فاصله ای حدود 5/1-1 سانتی متر از همدیگر) دیده می شود. (آلیاری و همكاران، 1379). پس از پایان مرحله روزت، ابتدا ساقه اصلی طویل می شود و پس از به گل نشستن ساقه اصلی، شاخه های فرعی نیز شروع به طویل شدن می‌كنند. میزان شاخه فرعی آن به واریته، محیط، تغذیه گیاه و تكنیك های زراعی بستگی دارد. (شیرانی راد و دهشیری، 1381). رنگ ساقه تا مرحله گل ،سبز بوده و به تدریج تا رسیدگی فیزیولوژیك[3] به رنگ كاهی در می آید ( آلیاری و همكاران،1379).

1-6-3- برگ

برگ های كلزا به سه فرم چسبیده ساقه آغوش، چسبیده معمولی و دارای دمبرگ می‌باشند. برگ‌های كلزا به صورت متناوب بر روی ساقه قرار می‌گیرند(شیرانی راد و دهشیری،1381). آرایش برگ‌های مزبور متناوب بوده و شكل عمومی آن‌ها بیضوی كشیده با كرك‌های متعدد می ‌باشد. تعداد آن ها بر روی ساقه اصلی در تیپ‌های بهاره در حدود 12 عدد و در تیپ‌های پائیزه بیش از 40 عدد می‌باشد ( آلیاری و همكاران،1379). برگ‌ها در زمان رسیدگی محصول شروع به زردی نموده و از قسمت پائین به سمت بالای بوته خشك شده و ریزش می‌نماید كه این امر باعث سهولت در برداشت می گردد( عاشوری،1380).

برای دریافت پروژه اینجا کلیک کنید

دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید

 دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word) دارای 124 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی ارائه میگردد

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word) :

دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word) دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word) دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)دانلود چنین محصولی در این فروشگاه قرار ندارد در فایل ورد (word)

برای دریافت پروژه اینجا کلیک کنید